Regulog NiaR - Streptococcaceae
| Regulator type: | Transcription factor |
| Regulator family: | NiaR |
| Regulation mode: | repressor |
| Biological process: | NAD biosynthesis |
| Effector: | Niacin |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Streptococcaceae
- By trascription factor - NiaR
- By TF family - NiaR
- By effector - Niacin
- By pathway - NAD biosynthesis
| Genome | Genes | Operons |
|---|---|---|
| Lactococcus lactis subsp. cremoris SK11 | ||
| Lactococcus lactis subsp. lactis Il1403 | ||
| Streptococcus agalactiae 2603V/R | 1 | 1 |
| Streptococcus dysgalactiae subsp. equisimilis GGS_124 | 2 | 2 |
| Streptococcus equi subsp. zooepidemicus MGCS10565 | 2 | 2 |
| Streptococcus gallolyticus UCN34 | 4 | 3 |
| Streptococcus gordonii str. Challis substr. CH1 | 1 | 1 |
| Streptococcus mitis B6 | 1 | 1 |
| Streptococcus mutans UA159 | 2 | 2 |
| Streptococcus pneumoniae TIGR4 | 3 | 3 |
| Streptococcus pyogenes M1 GAS | 3 | 3 |
| Streptococcus sanguinis SK36 | 1 | 1 |
| Streptococcus suis 05ZYH33 | 1 | 1 |
| Streptococcus thermophilus CNRZ1066 | 1 | 1 |
| Streptococcus uberis 0140J | 1 | 1 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| pnuC |
|
|
|
|
|
|
|
|
*
Streptococcus mutans UA159 Site: position = -74 score = 4.97617 sequence = aAtataTGTCTTgACACaTGTA Gene: SMU.946: Ribosyl nicotinamide transporter, PnuC-like |
*
Streptococcus pneumoniae TIGR4 Site: position = -188 score = 4.51005 sequence = TTTTACTGTAAAGACAGTTGAC Gene: SP_1859: Ribosyl nicotinamide transporter, PnuC-like |
|
Gene: SSA_1316: Ribosyl nicotinamide transporter, PnuC-like |
|
|
|
Ribosyl nicotinamide transporter, PnuC-like |
| CRON 2. | ||||||||||||||||
| pncA |
Gene: LACR_0273: Nicotinamidase (EC 3.5.1.19) |
Gene: L67226: Nicotinamidase (EC 3.5.1.19) |
Gene: SAG1674: Nicotinamidase (EC 3.5.1.19) |
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124 Site: position = -88 score = 4.81667 sequence = GTTAGTTGTCTTGACACCTGTA Gene: SDEG_1847: Nicotinamidase (EC 3.5.1.19) |
*
Streptococcus equi subsp. zooepidemicus MGCS10565 Site: position = -139 score = 5.05825 sequence = ATCTACTGTCTTGACAGCTGTC Gene: Sez_0388: Nicotinamidase (EC 3.5.1.19) |
Gene: GALLO_1875: Nicotinamidase (EC 3.5.1.19) |
Gene: SGO_0432: Nicotinamidase (EC 3.5.1.19) |
Gene: smi_0688: Nicotinamidase (EC 3.5.1.19) |
Gene: SMU.1823: Nicotinamidase (EC 3.5.1.19) |
Gene: SP_1583: Nicotinamidase (EC 3.5.1.19) |
*
Streptococcus pyogenes M1 GAS Site: position = -88 score = 4.6712 sequence = AATAGATGTCTTGATACCTGTA Gene: SPy1776: Nicotinamidase (EC 3.5.1.19) |
Gene: SSA_0567: Nicotinamidase (EC 3.5.1.19) |
Gene: SSU05_0351: Nicotinamidase (EC 3.5.1.19) |
Gene: str1634: Nicotinamidase (EC 3.5.1.19) |
Gene: SUB1527: Nicotinamidase (EC 3.5.1.19) |
Nicotinamidase (EC 3.5.1.19) |
| CRON 3. | ||||||||||||||||
| nadA |
|
|
|
|
|
*
Streptococcus gallolyticus UCN34 Site: position = -80 score = 5.58542 sequence = TACAGGTGTCTTGACACCTGGC Gene: GALLO_1937: Quinolinate synthetase A |
|
|
|
|
|
|
|
|
|
Quinolinate synthetase A |
| CRON 4. | ||||||||||||||||
| nadB |
|
|
|
|
|
*
Streptococcus gallolyticus UCN34 Site: position = -177 score = 4.65521 sequence = GCCAGGTGTCAAGACACCTGTA Gene: GALLO_1936: L-aspartate oxidase |
|
|
|
|
|
|
|
|
|
L-aspartate oxidase |
| nadC |
|
|
|
|
|
Gene: GALLO_1935: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
|
|
|
*
Streptococcus pneumoniae TIGR4 Site: position = -134 score = 5.95985 sequence = TACAATTGTCTTGACAATTGTC Site: position = -122 score = 5.65993 sequence = GACAATTGTCTTGACACTTGTT Gene: SP_2016: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
*
Streptococcus pyogenes M1 GAS Site: position = -122 score = 6.18288 sequence = TACAATTGTCTTGACACTTGTT Gene: SPy0197: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
|
|
|
|
Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) |
| CRON 5. | ||||||||||||||||
| niaX |
Gene: LACR_1282: Substrate-specific component NiaX of predicted niacin ECF transporter |
Gene: L173230: Substrate-specific component NiaX of predicted niacin ECF transporter |
*
Streptococcus agalactiae 2603V/R Site: position = -58 score = 6.37155 sequence = TACAGGTGTCTTTACACCTGTA Gene: SAG1602: Substrate-specific component NiaX of predicted niacin ECF transporter |
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124 Site: position = -59 score = 6.14424 sequence = TATAGGTGTCTTGACACTTGTA Gene: SDEG_1467: Substrate-specific component NiaX of predicted niacin ECF transporter |
*
Streptococcus equi subsp. zooepidemicus MGCS10565 Site: position = -62 score = 4.21863 sequence = GCTAGGTGTCTTGACATCTGTC Gene: Sez_0638: Substrate-specific component NiaX of predicted niacin ECF transporter |
*
Streptococcus gallolyticus UCN34 Site: position = -191 score = 5.83711 sequence = TACAGGTGTCTTGACACCTGTG Gene: GALLO_0647: Substrate-specific component NiaX of predicted niacin ECF transporter |
*
Streptococcus gordonii str. Challis substr. CH1 Site: position = -32 score = 6.20346 sequence = TACTACTGTATATACACATAAA Gene: SGO_1046: Substrate-specific component NiaX of predicted niacin ECF transporter |
*
Streptococcus mitis B6 Site: position = -33 score = 6.51414 sequence = TACTAGTGTATATACAGTTAAA Gene: smi_1196: Substrate-specific component NiaX of predicted niacin ECF transporter |
*
Streptococcus mutans UA159 Site: position = -67 score = 6.29071 sequence = AACTAGTGTCTTGACAGATGTA Gene: SMU.332: Substrate-specific component NiaX of predicted niacin ECF transporter |
*
Streptococcus pneumoniae TIGR4 Site: position = 20 score = 6.18018 sequence = TACTAGTGTATATGCAGTTAAA Gene: SP_1233: Substrate-specific component NiaX of predicted niacin ECF transporter |
*
Streptococcus pyogenes M1 GAS Site: position = -59 score = 5.5942 sequence = TACAGGTGTCTTGATAGTTATT Gene: SPy1425: Substrate-specific component NiaX of predicted niacin ECF transporter |
*
Streptococcus sanguinis SK36 Site: position = -33 score = 6.47971 sequence = TACTAGTGTATATACAGATAAA Gene: SSA_1348: Substrate-specific component NiaX of predicted niacin ECF transporter |
*
Streptococcus suis 05ZYH33 Site: position = -173 score = 5.80434 sequence = TACAGGCGTCTTGACACCTGTA Gene: SSU05_2019: Substrate-specific component NiaX of predicted niacin ECF transporter |
*
Streptococcus thermophilus CNRZ1066 Site: position = 28 score = 6.10262 sequence = TACTATTGTATTTACAGAAAAA Gene: str0890: Substrate-specific component NiaX of predicted niacin ECF transporter |
*
Streptococcus uberis 0140J Site: position = -58 score = 6.34289 sequence = TACAGGTGTCTTGACACCTGTA Gene: SUB1261: Substrate-specific component NiaX of predicted niacin ECF transporter |
Substrate-specific component NiaX of predicted niacin ECF transporter |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |