Regulog NiaR - Streptococcaceae

Properties
Regulator type:	Transcription factor
Regulator family:	NiaR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Niacin
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 23 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By trascription factor - NiaR
By TF family - NiaR
By effector - Niacin
By pathway - NAD biosynthesis

Statistics of regulated genes
Genome	Genes	Operons
Lactococcus lactis subsp. cremoris SK11
Lactococcus lactis subsp. lactis Il1403
Streptococcus agalactiae 2603V/R	1	1
Streptococcus dysgalactiae subsp. equisimilis GGS_124	2	2
Streptococcus equi subsp. zooepidemicus MGCS10565	2	2
Streptococcus gallolyticus UCN34	4	3
Streptococcus gordonii str. Challis substr. CH1	1	1
Streptococcus mitis B6	1	1
Streptococcus mutans UA159	2	2
Streptococcus pneumoniae TIGR4	3	3
Streptococcus pyogenes M1 GAS	3	3
Streptococcus sanguinis SK36	1	1
Streptococcus suis 05ZYH33	1	1
Streptococcus thermophilus CNRZ1066	1	1
Streptococcus uberis 0140J	1	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																Function

CRON 1.
pnuC	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	* Streptococcus mutans UA159 Site: position = -74 score = 4.97617 sequence = aAtataTGTCTTgACACaTGTA Gene: SMU.946: Ribosyl nicotinamide transporter, PnuC-like	* Streptococcus pneumoniae TIGR4 Site: position = -188 score = 4.51005 sequence = TTTTACTGTAAAGACAGTTGAC Gene: SP_1859: Ribosyl nicotinamide transporter, PnuC-like	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36 Gene: SSA_1316: Ribosyl nicotinamide transporter, PnuC-like	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J	Ribosyl nicotinamide transporter, PnuC-like

CRON 2.
pncA	Lactococcus lactis subsp. cremoris SK11 Gene: LACR_0273: Nicotinamidase (EC 3.5.1.19)	Lactococcus lactis subsp. lactis Il1403 Gene: L67226: Nicotinamidase (EC 3.5.1.19)	Streptococcus agalactiae 2603V/R Gene: SAG1674: Nicotinamidase (EC 3.5.1.19)	* Streptococcus dysgalactiae subsp. equisimilis GGS_124 Site: position = -88 score = 4.81667 sequence = GTTAGTTGTCTTGACACCTGTA Gene: SDEG_1847: Nicotinamidase (EC 3.5.1.19)	* Streptococcus equi subsp. zooepidemicus MGCS10565 Site: position = -139 score = 5.05825 sequence = ATCTACTGTCTTGACAGCTGTC Gene: Sez_0388: Nicotinamidase (EC 3.5.1.19)	Streptococcus gallolyticus UCN34 Gene: GALLO_1875: Nicotinamidase (EC 3.5.1.19)	Streptococcus gordonii str. Challis substr. CH1 Gene: SGO_0432: Nicotinamidase (EC 3.5.1.19)	Streptococcus mitis B6 Gene: smi_0688: Nicotinamidase (EC 3.5.1.19)	Streptococcus mutans UA159 Gene: SMU.1823: Nicotinamidase (EC 3.5.1.19)	Streptococcus pneumoniae TIGR4 Gene: SP_1583: Nicotinamidase (EC 3.5.1.19)	* Streptococcus pyogenes M1 GAS Site: position = -88 score = 4.6712 sequence = AATAGATGTCTTGATACCTGTA Gene: SPy1776: Nicotinamidase (EC 3.5.1.19)	Streptococcus sanguinis SK36 Gene: SSA_0567: Nicotinamidase (EC 3.5.1.19)	Streptococcus suis 05ZYH33 Gene: SSU05_0351: Nicotinamidase (EC 3.5.1.19)	Streptococcus thermophilus CNRZ1066 Gene: str1634: Nicotinamidase (EC 3.5.1.19)	Streptococcus uberis 0140J Gene: SUB1527: Nicotinamidase (EC 3.5.1.19)	Nicotinamidase (EC 3.5.1.19)

CRON 3.
nadA	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	* Streptococcus gallolyticus UCN34 Site: position = -80 score = 5.58542 sequence = TACAGGTGTCTTGACACCTGGC Gene: GALLO_1937: Quinolinate synthetase A	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J	Quinolinate synthetase A

CRON 4.
nadB	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	* Streptococcus gallolyticus UCN34 Site: position = -177 score = 4.65521 sequence = GCCAGGTGTCAAGACACCTGTA Gene: GALLO_1936: L-aspartate oxidase	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J	L-aspartate oxidase
nadC	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34 Gene: GALLO_1935: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159	* Streptococcus pneumoniae TIGR4 Site: position = -134 score = 5.95985 sequence = TACAATTGTCTTGACAATTGTC Site: position = -122 score = 5.65993 sequence = GACAATTGTCTTGACACTTGTT Gene: SP_2016: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)	* Streptococcus pyogenes M1 GAS Site: position = -122 score = 6.18288 sequence = TACAATTGTCTTGACACTTGTT Gene: SPy0197: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)	Streptococcus sanguinis SK36	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J	Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)

CRON 5.
niaX	Lactococcus lactis subsp. cremoris SK11 Gene: LACR_1282: Substrate-specific component NiaX of predicted niacin ECF transporter	Lactococcus lactis subsp. lactis Il1403 Gene: L173230: Substrate-specific component NiaX of predicted niacin ECF transporter	* Streptococcus agalactiae 2603V/R Site: position = -58 score = 6.37155 sequence = TACAGGTGTCTTTACACCTGTA Gene: SAG1602: Substrate-specific component NiaX of predicted niacin ECF transporter	* Streptococcus dysgalactiae subsp. equisimilis GGS_124 Site: position = -59 score = 6.14424 sequence = TATAGGTGTCTTGACACTTGTA Gene: SDEG_1467: Substrate-specific component NiaX of predicted niacin ECF transporter	* Streptococcus equi subsp. zooepidemicus MGCS10565 Site: position = -62 score = 4.21863 sequence = GCTAGGTGTCTTGACATCTGTC Gene: Sez_0638: Substrate-specific component NiaX of predicted niacin ECF transporter	* Streptococcus gallolyticus UCN34 Site: position = -191 score = 5.83711 sequence = TACAGGTGTCTTGACACCTGTG Gene: GALLO_0647: Substrate-specific component NiaX of predicted niacin ECF transporter	* Streptococcus gordonii str. Challis substr. CH1 Site: position = -32 score = 6.20346 sequence = TACTACTGTATATACACATAAA Gene: SGO_1046: Substrate-specific component NiaX of predicted niacin ECF transporter	* Streptococcus mitis B6 Site: position = -33 score = 6.51414 sequence = TACTAGTGTATATACAGTTAAA Gene: smi_1196: Substrate-specific component NiaX of predicted niacin ECF transporter	* Streptococcus mutans UA159 Site: position = -67 score = 6.29071 sequence = AACTAGTGTCTTGACAGATGTA Gene: SMU.332: Substrate-specific component NiaX of predicted niacin ECF transporter	* Streptococcus pneumoniae TIGR4 Site: position = 20 score = 6.18018 sequence = TACTAGTGTATATGCAGTTAAA Gene: SP_1233: Substrate-specific component NiaX of predicted niacin ECF transporter	* Streptococcus pyogenes M1 GAS Site: position = -59 score = 5.5942 sequence = TACAGGTGTCTTGATAGTTATT Gene: SPy1425: Substrate-specific component NiaX of predicted niacin ECF transporter	* Streptococcus sanguinis SK36 Site: position = -33 score = 6.47971 sequence = TACTAGTGTATATACAGATAAA Gene: SSA_1348: Substrate-specific component NiaX of predicted niacin ECF transporter	* Streptococcus suis 05ZYH33 Site: position = -173 score = 5.80434 sequence = TACAGGCGTCTTGACACCTGTA Gene: SSU05_2019: Substrate-specific component NiaX of predicted niacin ECF transporter	* Streptococcus thermophilus CNRZ1066 Site: position = 28 score = 6.10262 sequence = TACTATTGTATTTACAGAAAAA Gene: str0890: Substrate-specific component NiaX of predicted niacin ECF transporter	* Streptococcus uberis 0140J Site: position = -58 score = 6.34289 sequence = TACAGGTGTCTTGACACCTGTA Gene: SUB1261: Substrate-specific component NiaX of predicted niacin ECF transporter	Substrate-specific component NiaX of predicted niacin ECF transporter

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog NiaR - Streptococcaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --