Regulon of NiaR in Streptococcus gallolyticus UCN34

Properties
Regulator type:	Transcription factor
TF locus tag:	GALLO_0646
Regulator family:	NiaR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Niacin
Regulog:	NiaR - Streptococcaceae
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 23 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By trascription factor - NiaR
By TF family - NiaR
By effector - Niacin
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -191 Score: 5.8 Sequence: TACAGGTGTCTTGACACCTGTG Locus tag: GALLO_0647 Name: niaX Funciton: Substrate-specific component NiaX of predicted niacin ECF transporter
	GALLO_0647	niaX	Substrate-specific component NiaX of predicted niacin ECF transporter
Position: -80 Score: 5.6 Sequence: TACAGGTGTCTTGACACCTGGC Locus tag: GALLO_1937 Name: nadA Funciton: Quinolinate synthetase A
	GALLO_1937	nadA	Quinolinate synthetase A
Position: -177 Score: 4.7 Sequence: GCCAGGTGTCAAGACACCTGTA Locus tag: GALLO_1936 Name: nadB Funciton: L-aspartate oxidase Locus tag: GALLO_1935 Name: nadC Funciton: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
	GALLO_1936	nadB	L-aspartate oxidase
	GALLO_1935	nadC	Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD