Regulon of NiaR in Streptococcus gordonii str. Challis substr. CH1
| Regulator type: | Transcription factor |
| TF locus tag: | SGO_1045 |
| Regulator family: | NiaR |
| Regulation mode: | repressor |
| Biological process: | NAD biosynthesis |
| Effector: | Niacin |
| Regulog: | NiaR - Streptococcaceae |
| Statistics of regulated genes: | |
| - Genes | 1 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Streptococcaceae
- By trascription factor - NiaR
- By TF family - NiaR
- By effector - Niacin
- By pathway - NAD biosynthesis
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -32
Score: 6.2 Sequence: TACTACTGTATATACACATAAA
Locus tag: SGO_1046
Name: niaX Funciton: Substrate-specific component NiaX of predicted niacin ECF transporter |
|||
|
niaX
|
Substrate-specific component NiaX of predicted niacin ECF transporter
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |