Regulon of NiaR in Streptococcus gordonii str. Challis substr. CH1

Properties
Regulator type:	Transcription factor
TF locus tag:	SGO_1045
Regulator family:	NiaR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Niacin
Regulog:	NiaR - Streptococcaceae
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 23 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By trascription factor - NiaR
By TF family - NiaR
By effector - Niacin
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -32 Score: 6.2 Sequence: TACTACTGTATATACACATAAA Locus tag: SGO_1046 Name: niaX Funciton: Substrate-specific component NiaX of predicted niacin ECF transporter
	SGO_1046	niaX	Substrate-specific component NiaX of predicted niacin ECF transporter

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD