Regulon of NiaR in Streptococcus pyogenes M1 GAS

Properties
Regulator type:	Transcription factor
TF locus tag:	SPy1427
Regulator family:	NiaR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Niacin
Regulog:	NiaR - Streptococcaceae
Statistics of regulated genes:
- Genes	3
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 23 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By trascription factor - NiaR
By TF family - NiaR
By effector - Niacin
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -59 Score: 5.6 Sequence: TACAGGTGTCTTGATAGTTATT Locus tag: SPy1425 Name: niaX Funciton: Substrate-specific component NiaX of predicted niacin ECF transporter
	SPy1425	niaX	Substrate-specific component NiaX of predicted niacin ECF transporter
Position: -88 Score: 4.7 Sequence: AATAGATGTCTTGATACCTGTA Locus tag: SPy1776 Name: pncA Funciton: Nicotinamidase (EC 3.5.1.19)
	SPy1776	pncA	Nicotinamidase (EC 3.5.1.19)
Position: -122 Score: 6.2 Sequence: TACAATTGTCTTGACACTTGTT Locus tag: SPy0197 Name: nadC Funciton: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
	SPy0197	nadC	Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD