Regulon of NiaR in Streptococcus mutans UA159
Regulator type: | Transcription factor |
TF locus tag: | SMU.331 |
Regulator family: | NiaR |
Regulation mode: | repressor |
Biological process: | NAD biosynthesis |
Effector: | Niacin |
Regulog: | NiaR - Streptococcaceae |
Statistics of regulated genes: | |
- Genes | 2 |
- Operons | 2 |
Visualization: | |
![]() |
Allows to visualize regulon content in the context of metabolic pathways |

Member of regulog collections
- By taxonomy - Streptococcaceae
- By trascription factor - NiaR
- By TF family - NiaR
- By effector - Niacin
- By pathway - NAD biosynthesis
Locus Tag | Name | Function | |
---|---|---|---|
Position: -67
Score: 6.3 Sequence: AACTAGTGTCTTGACAGATGTA
Locus tag: SMU.332
Name: niaX Funciton: Substrate-specific component NiaX of predicted niacin ECF transporter |
|||
niaX
|
Substrate-specific component NiaX of predicted niacin ECF transporter
|
||
Position: -74
Score: 5 Sequence: aAtataTGTCTTgACACaTGTA
Locus tag: SMU.946
Name: pnuC Funciton: Ribosyl nicotinamide transporter, PnuC-like |
|||
pnuC
|
Ribosyl nicotinamide transporter, PnuC-like
|
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |