Regulon of NiaR in Streptococcus pneumoniae TIGR4

Properties
Regulator type:	Transcription factor
TF locus tag:	SP_1234
Regulator family:	NiaR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Niacin
Regulog:	NiaR - Streptococcaceae
Statistics of regulated genes:
- Genes	3
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 23 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By trascription factor - NiaR
By TF family - NiaR
By effector - Niacin
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -188 Score: 4.5 Sequence: TTTTACTGTAAAGACAGTTGAC Locus tag: SP_1859 Name: pnuC Funciton: Ribosyl nicotinamide transporter, PnuC-like
	SP_1859	pnuC	Ribosyl nicotinamide transporter, PnuC-like
Position: 20 Score: 6.2 Sequence: TACTAGTGTATATGCAGTTAAA Locus tag: SP_1233 Name: niaX Funciton: Substrate-specific component NiaX of predicted niacin ECF transporter
	SP_1233	niaX	Substrate-specific component NiaX of predicted niacin ECF transporter
Position: -134 Score: 6 Sequence: TACAATTGTCTTGACAATTGTC Position: -122 Score: 5.7 Sequence: GACAATTGTCTTGACACTTGTT Locus tag: SP_2016 Name: nadC Funciton: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
	SP_2016	nadC	Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD