Regulog PsrA - Caulobacterales

Properties
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Fatty acid degradation
Effector:	Oleate
Phylum:	Proteobacteria/alpha
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 70 sites [see more]

Member of regulog collections

By trascription factor - PsrA
By taxonomy - Caulobacterales
By TF family - TetR
By effector - Oleate
By pathway - Fatty acid degradation

Statistics of regulated genes
Genome	Genes	Operons
Caulobacter crescentus CB15	34	22
Caulobacter segnis ATCC 21756	30	19
Caulobacter sp. K31	30	21
Phenylobacterium zucineum HLK1	7	6

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes					Function

CRON 1.
acdH	* Caulobacter crescentus CB15 Site: position = -47 score = 5.89313 sequence = CTTCAAACAAGCGTTTGACA Gene: CC0690: Acyl-CoA dehydrogenase (EC 1.3.99.3)	* Caulobacter segnis ATCC 21756 Site: position = -46 score = 5.89313 sequence = CTTCAAACAAGTGTTTGACA Gene: Cseg_3689: Acyl-CoA dehydrogenase (EC 1.3.99.3)	* Caulobacter sp. K31 Site: position = -45 score = 5.92873 sequence = TTTCAAACAAGCGTTTGACA Gene: Caul_4071: Acyl-CoA dehydrogenase (EC 1.3.99.3)	* Phenylobacterium zucineum HLK1 Site: position = -32 score = 5.97578 sequence = ATTCAAACAAGCGTTTGAAC Gene: PHZ_c3174: Acyl-CoA dehydrogenase (EC 1.3.99.3)	Acyl-CoA dehydrogenase (EC 1.3.99.3)

CRON 2.
CC0244	* Caulobacter crescentus CB15 Site: position = -25 score = 5.50524 sequence = GCTCAAACAAGCGTTTGAGG Gene: CC0244: HAD-superfamily hydrolase	* Caulobacter segnis ATCC 21756 Site: position = -27 score = 5.55563 sequence = CCTCAAACAATTGTTTGAGG Gene: Cseg_0190: HAD-superfamily hydrolase	* Caulobacter sp. K31 Site: position = -25 score = 5.33973 sequence = GATCAAACAGTTGTTTGAGG Gene: Caul_4647: HAD-superfamily hydrolase	Phenylobacterium zucineum HLK1 Gene: PHZ_c0076: HAD-superfamily hydrolase	HAD-superfamily hydrolase
phhB	Caulobacter crescentus CB15 Gene: CC0245: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)	Caulobacter segnis ATCC 21756 Gene: Cseg_0191: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)	Caulobacter sp. K31 Gene: Caul_4648: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)	Phenylobacterium zucineum HLK1 Gene: PHZ_c0077: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)	Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
CC0246	* Caulobacter crescentus CB15 Site: position = -41 score = 5.52 sequence = ATTCAAACTGCTGTTTGAAT Gene: CC0246: 2,5-dichloro-2,5-cyclohexadiene-1,4-diol dehydrogenase	* Caulobacter segnis ATCC 21756 Site: position = -40 score = 5.61749 sequence = ATTCAAACTCGCGTTTGAAT Gene: Cseg_0192: 2,5-dichloro-2,5-cyclohexadiene-1,4-diol dehydrogenase	* Caulobacter sp. K31 Site: position = -40 score = 5.79331 sequence = GTTCAAACTATCGTTTGAAT Gene: Caul_4649: 2,5-dichloro-2,5-cyclohexadiene-1,4-diol dehydrogenase	Phenylobacterium zucineum HLK1 Gene: PHZ_c0078: 2,5-dichloro-2,5-cyclohexadiene-1,4-diol dehydrogenase	2,5-dichloro-2,5-cyclohexadiene-1,4-diol dehydrogenase

CRON 3.
paaI2	Caulobacter crescentus CB15	Caulobacter segnis ATCC 21756	* Caulobacter sp. K31 Site: position = -42 score = 5.82967 sequence = AGTCAAACAAATGTTTGAAT Gene: Caul_4897: Phenylacetic acid degradation protein paaI	Phenylobacterium zucineum HLK1 Gene: PHZ_c1939: Phenylacetic acid degradation protein paaI	Phenylacetic acid degradation protein paaI

CRON 4.
paaI	* Caulobacter crescentus CB15 Site: position = -26 score = 5.00147 sequence = TTTCAAACGCTTGTTAGCCT Gene: CC3309: Phenylacetic acid degradation protein paaI	* Caulobacter segnis ATCC 21756 Site: position = -26 score = 5.14027 sequence = TTTCAAACGATCGTTAGCCT Gene: Cseg_0614: Phenylacetic acid degradation protein paaI	* Caulobacter sp. K31 Site: position = -26 score = 5.44987 sequence = GTTCAAACGCTCGTTAGACT Gene: Caul_0887: Phenylacetic acid degradation protein paaI	Phenylobacterium zucineum HLK1	Phenylacetic acid degradation protein paaI
CC3308	Caulobacter crescentus CB15 Gene: CC3308: alpha/beta hydrolase fold protein	Caulobacter segnis ATCC 21756 Gene: Cseg_0615: alpha/beta hydrolase fold protein	Caulobacter sp. K31 Gene: Caul_0888: alpha/beta hydrolase fold protein	* Phenylobacterium zucineum HLK1 Site: position = -116 score = 5.18426 sequence = TTTCAAACGGCCGTTAGACC Gene: PHZ_c3105: alpha/beta hydrolase fold protein	alpha/beta hydrolase fold protein

CRON 5.
CC2074	* Caulobacter crescentus CB15 Site: position = -29 score = 5.052 sequence = ATCCGAACACCTGTTCGAAA Gene: CC2074: Bll6692 protein	* Caulobacter segnis ATCC 21756 Site: position = -28 score = 5.1908 sequence = ATCCGAACAACCGTTCGAAA Gene: Cseg_1354: Bll6692 protein	* Caulobacter sp. K31 Site: position = -41 score = 5.47838 sequence = CTTCGAACAATCGTTCGAAA Gene: Caul_3321: Bll6692 protein	* Phenylobacterium zucineum HLK1 Site: position = -36 score = 5.31248 sequence = GTTCAAACGATTGTTCGCCT Gene: PHZ_c0904: Bll6692 protein	Bll6692 protein
psrA	* Caulobacter crescentus CB15 Site: position = -46 score = 4.37099 sequence = ATTCGAACGCCCGTAAGACT Gene: CC2080: Transcriptional regulator for fatty acid degradation PsrA, TetR family	Caulobacter segnis ATCC 21756	Caulobacter sp. K31	Phenylobacterium zucineum HLK1 Gene: PHZ_c0903: Transcriptional regulator for fatty acid degradation PsrA, TetR family	Transcriptional regulator for fatty acid degradation PsrA, TetR family

CRON 6.
CC3076	* Caulobacter crescentus CB15 Site: position = -28 score = 5.26147 sequence = ATTCAAACAAACGTTTAGGG Gene: CC3076: Oxidoreductase, short-chain dehydrogenase/reductase family	* Caulobacter segnis ATCC 21756 Site: position = -28 score = 5.26147 sequence = ATTCAAACAAACGTTTAGGG Gene: Cseg_3639: Oxidoreductase, short-chain dehydrogenase/reductase family	* Caulobacter sp. K31 Site: position = -28 score = 5.38057 sequence = ATTCAAACAAACGTTTAGCG Gene: Caul_0851: Oxidoreductase, short-chain dehydrogenase/reductase family	* Phenylobacterium zucineum HLK1 Site: position = -39 score = 5.44558 sequence = AGTCAAACAACTGTTTGGGA Gene: PHZ_c3135: Oxidoreductase, short-chain dehydrogenase/reductase family	Oxidoreductase, short-chain dehydrogenase/reductase family

CRON 7.
fadB	* Caulobacter crescentus CB15 Site: position = -45 score = 5.21868 sequence = TGTCAAACAACCGTTCAAAC Gene: CC3189: Enoyl-CoA hydratase (EC 4.2.1.17) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)	* Caulobacter segnis ATCC 21756 Site: position = -166 score = 4.79426 sequence = ACTGAAACTATCGTTCGAAT Site: position = -52 score = 4.79241 sequence = TCTCAAACGGTTGTTCAAGC Gene: Cseg_0771: Enoyl-CoA hydratase (EC 4.2.1.17) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)	* Caulobacter sp. K31 Site: position = -53 score = 5.40245 sequence = CTTCAAACAACCGTTCAAAA Gene: Caul_0813: Enoyl-CoA hydratase (EC 4.2.1.17) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)	* Phenylobacterium zucineum HLK1 Site: position = -81 score = 4.61358 sequence = CCTATAACACGCGTTTGAAT Gene: PHZ_c3217: Enoyl-CoA hydratase (EC 4.2.1.17) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)	Enoyl-CoA hydratase (EC 4.2.1.17) / 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35) / 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3)
fadD	Caulobacter crescentus CB15 Gene: CC3188: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)	Caulobacter segnis ATCC 21756 Gene: Cseg_0772: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)	Caulobacter sp. K31 Gene: Caul_0814: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)	Phenylobacterium zucineum HLK1 Gene: PHZ_c2510: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)	Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)

CRON 8.
fadA	* Caulobacter crescentus CB15 Site: position = -34 score = 5.35264 sequence = ATTCAAACTAACGTTTAACG Gene: CC3462: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)	* Caulobacter segnis ATCC 21756 Site: position = -34 score = 5.08613 sequence = ATTCAAACTAATGTTTTAAC Gene: Cseg_0226: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)	* Caulobacter sp. K31 Site: position = -34 score = 5.39117 sequence = ATTCAAACTAACGTTTAAAG Gene: Caul_4752: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)	* Phenylobacterium zucineum HLK1 Site: position = -53 score = 5.03282 sequence = GTTCCAACGCTTGTTTAAAA Gene: PHZ_c0760: 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)	3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9)

CRON 9.
CC2049	* Caulobacter crescentus CB15 Site: position = -89 score = 5.39627 sequence = ATGCGAACGATCGTTTGAAT Gene: CC2049: Acyl-CoA dehydrogenase family protein	* Caulobacter segnis ATCC 21756 Site: position = -113 score = 5.03636 sequence = CGGCGAACGAGCGTTTGAAT Gene: Cseg_1384: Acyl-CoA dehydrogenase family protein	* Caulobacter sp. K31 Site: position = -119 score = 4.77876 sequence = TGACGAACGGACGTTTGAAT Gene: Caul_1447: Acyl-CoA dehydrogenase family protein	Phenylobacterium zucineum HLK1	Acyl-CoA dehydrogenase family protein
Cseg_1383	Caulobacter crescentus CB15	Caulobacter segnis ATCC 21756 Gene: Cseg_1383: DSBA oxidoreductase	Caulobacter sp. K31 Gene: Caul_1446: DSBA oxidoreductase	Phenylobacterium zucineum HLK1	DSBA oxidoreductase
CC2050	Caulobacter crescentus CB15 Gene: CC2050: Acyl-CoA dehydrogenase family protein	Caulobacter segnis ATCC 21756 Gene: Cseg_1382: Acyl-CoA dehydrogenase family protein	Caulobacter sp. K31 Gene: Caul_1445: Acyl-CoA dehydrogenase family protein	Phenylobacterium zucineum HLK1	Acyl-CoA dehydrogenase family protein

CRON 10.
echH	* Caulobacter crescentus CB15 Site: position = -39 score = 5.10832 sequence = GGTCATACGATCGTTTAAAA Gene: CC0947: Enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17)	* Caulobacter segnis ATCC 21756 Site: position = -45 score = 5.38576 sequence = GGTCATACGATCGTTTGAAA Gene: Cseg_3348: Enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17)	* Caulobacter sp. K31 Site: position = -43 score = 5.15101 sequence = GTTCATACGCGTGTTTGAGT Gene: Caul_1349: Enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17)	Phenylobacterium zucineum HLK1 Gene: PHZ_c2717: Enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17)	Enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17)

CRON 11.
CC1568	* Caulobacter crescentus CB15 Site: position = -27 score = 5.37676 sequence = TCTCAAACAATTGTTTGGGA Gene: CC1568: Beta-lactamase class C and other penicillin binding proteins	* Caulobacter segnis ATCC 21756 Site: position = -27 score = 5.11358 sequence = TGTCAAACGAGTGTTCGGGA Gene: Cseg_2635: Beta-lactamase class C and other penicillin binding proteins	* Caulobacter sp. K31 Site: position = -30 score = 4.99298 sequence = CCTCAAACAACTGTTCGGGA Gene: Caul_3066: Beta-lactamase class C and other penicillin binding proteins	Phenylobacterium zucineum HLK1	Beta-lactamase class C and other penicillin binding proteins
CC1569	Caulobacter crescentus CB15 Gene: CC1569: NADP-dependent quinone oxidoreductase, putative	Caulobacter segnis ATCC 21756 Gene: Cseg_2634: NADP-dependent quinone oxidoreductase, putative	Caulobacter sp. K31 Gene: Caul_3065: NADP-dependent quinone oxidoreductase, putative	Phenylobacterium zucineum HLK1	NADP-dependent quinone oxidoreductase, putative
fabL	Caulobacter crescentus CB15 Gene: CC1570: ENOYL-[ACYL-CARRIER-PROTEIN] REDUCTASE (fabL) (NADPH) (EC 1.3.1.9)	Caulobacter segnis ATCC 21756 Gene: Cseg_2633: ENOYL-[ACYL-CARRIER-PROTEIN] REDUCTASE (fabL) (NADPH) (EC 1.3.1.9)	Caulobacter sp. K31 Gene: Caul_3064: ENOYL-[ACYL-CARRIER-PROTEIN] REDUCTASE (fabL) (NADPH) (EC 1.3.1.9)	Phenylobacterium zucineum HLK1	ENOYL-[ACYL-CARRIER-PROTEIN] REDUCTASE (fabL) (NADPH) (EC 1.3.1.9)

CRON 12.
CC3380	* Caulobacter crescentus CB15 Site: position = -41 score = 5.33371 sequence = CTTCAAACAAGCGTTTCAAG Gene: CC3380: Short-chain dehydrogenase/reductase SDR	* Caulobacter segnis ATCC 21756 Site: position = -39 score = 5.26773 sequence = CTTCAAACAAGCGTTCAAGA Gene: Cseg_0314: Short-chain dehydrogenase/reductase SDR	* Caulobacter sp. K31 Site: position = -30 score = 4.9578 sequence = TTTCGAACAAATGTTCGGGA Gene: Caul_4412: Short-chain dehydrogenase/reductase SDR	Phenylobacterium zucineum HLK1 Gene: PHZ_c1079: Short-chain dehydrogenase/reductase SDR	Short-chain dehydrogenase/reductase SDR

CRON 13.
CC0942	* Caulobacter crescentus CB15 Site: position = -30 score = 5.31562 sequence = ATCCAAACAACTGTTCGAGG Gene: CC0942: aldehyde dehydrogenase	* Caulobacter segnis ATCC 21756 Site: position = -31 score = 5.30362 sequence = ATCCAAACAAATGTTTGGGA Gene: Cseg_3353: aldehyde dehydrogenase	* Caulobacter sp. K31 Site: position = -41 score = 4.97376 sequence = AATCAAACAACTGTTTACAA Gene: Caul_1346: aldehyde dehydrogenase	Phenylobacterium zucineum HLK1 Gene: PHZ_c2720: aldehyde dehydrogenase	aldehyde dehydrogenase

CRON 14.
CC1310	* Caulobacter crescentus CB15 Site: position = -86 score = 4.95329 sequence = TTCCAAACGGCCGTTCGAGC Gene: CC1310: Acyl-CoA dehydrogenase, long-chain specific (EC 1.3.99.13)	* Caulobacter segnis ATCC 21756 Site: position = -87 score = 5.19171 sequence = TTCCAAACGGTCGTTCGACC Gene: Cseg_1597: Acyl-CoA dehydrogenase, long-chain specific (EC 1.3.99.13)	* Caulobacter sp. K31 Site: position = -82 score = 5.30482 sequence = TTCCAAACGCTCGTTCGAAC Gene: Caul_2048: Acyl-CoA dehydrogenase, long-chain specific (EC 1.3.99.13)	Phenylobacterium zucineum HLK1 Gene: PHZ_c2336: Acyl-CoA dehydrogenase, long-chain specific (EC 1.3.99.13)	Acyl-CoA dehydrogenase, long-chain specific (EC 1.3.99.13)
CC1311	Caulobacter crescentus CB15 Gene: CC1311: Acyl-CoA dehydrogenase family protein	Caulobacter segnis ATCC 21756 Gene: Cseg_1598: Acyl-CoA dehydrogenase family protein	Caulobacter sp. K31 Gene: Caul_2049: Acyl-CoA dehydrogenase family protein	Phenylobacterium zucineum HLK1 Gene: PHZ_c2335: Acyl-CoA dehydrogenase family protein	Acyl-CoA dehydrogenase family protein

CRON 15.
CC0427	* Caulobacter crescentus CB15 Site: position = -69 score = 5.23925 sequence = GGCAAAACAAGCGTTTGACG Gene: CC0427: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)	* Caulobacter segnis ATCC 21756 Site: position = -64 score = 5.17304 sequence = GTCAAAACAGATGTTTGACA Gene: Cseg_3758: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)	* Caulobacter sp. K31 Site: position = -35 score = 5.23176 sequence = CGCAAAACAAGTGTTTGAAG Gene: Caul_0274: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)	Phenylobacterium zucineum HLK1 Gene: PHZ_c0890: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)	Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)

CRON 16.
CC3087	* Caulobacter crescentus CB15 Site: position = -34 score = 4.62752 sequence = AAGAAAACAACTGTTTGGGC Gene: CC3087: Methylsuccinyl-CoA dehydrogenase, predicted by (Erb et al, 2007)	* Caulobacter segnis ATCC 21756 Site: position = -52 score = 4.92723 sequence = AAGAAAACAATTGTTTGGCT Site: position = -34 score = 5.18752 sequence = CTTAAAACACCTGTTTGGCC Gene: Cseg_3655: Methylsuccinyl-CoA dehydrogenase, predicted by (Erb et al, 2007)	* Caulobacter sp. K31 Site: position = -34 score = 4.76953 sequence = AAGAAAACAACTGTTTGGCG Gene: Caul_1059: Methylsuccinyl-CoA dehydrogenase, predicted by (Erb et al, 2007)	Phenylobacterium zucineum HLK1 Gene: PHZ_c3145: Methylsuccinyl-CoA dehydrogenase, predicted by (Erb et al, 2007)	Methylsuccinyl-CoA dehydrogenase, predicted by (Erb et al, 2007)

CRON 17.
CC2093	* Caulobacter crescentus CB15 Site: position = -31 score = 5.05432 sequence = AACCAAACACACGTTTGAGG Gene: CC2093: Oxidoreductase, short chain dehydrogenase/reductase family	* Caulobacter segnis ATCC 21756 Site: position = -31 score = 5.10362 sequence = AACCAAACACGCGTTTGAGG Gene: Cseg_1333: Oxidoreductase, short chain dehydrogenase/reductase family	* Caulobacter sp. K31 Site: position = -31 score = 5.10362 sequence = AACCAAACACGCGTTTGAGG Gene: Caul_3341: Oxidoreductase, short chain dehydrogenase/reductase family	Phenylobacterium zucineum HLK1 Gene: PHZ_c0881: Oxidoreductase, short chain dehydrogenase/reductase family	Oxidoreductase, short chain dehydrogenase/reductase family
fadL	Caulobacter crescentus CB15 Gene: CC2094: Long-chain fatty acid transport protein	Caulobacter segnis ATCC 21756 Gene: Cseg_1332: Long-chain fatty acid transport protein	Caulobacter sp. K31 Gene: Caul_3342: Long-chain fatty acid transport protein	Phenylobacterium zucineum HLK1 Gene: PHZ_c0773: Long-chain fatty acid transport protein	Long-chain fatty acid transport protein

CRON 18.
CC3089	* Caulobacter crescentus CB15 Site: position = -70 score = 4.83742 sequence = GGGCGAACAGATGTTTGACT Gene: CC3089: Bll1370 protein	* Caulobacter segnis ATCC 21756 Site: position = -68 score = 4.79013 sequence = CGACGAACGCGCGTTTGACG Gene: Cseg_0869: Bll1370 protein	* Caulobacter sp. K31 Site: position = -70 score = 4.99748 sequence = ATCCGAACATCCGTTTGACT Gene: Caul_4261: Bll1370 protein	Phenylobacterium zucineum HLK1	Bll1370 protein

CRON 19.
CC2407	* Caulobacter crescentus CB15 Site: position = -40 score = 4.52955 sequence = CATCTAACAAGTGTTTGATC Gene: CC1111: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)	Caulobacter segnis ATCC 21756 Gene: Cseg_1757: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)	* Caulobacter sp. K31 Site: position = -29 score = 4.98052 sequence = CGTCAAACATCCGTTCGAGA Gene: Caul_1696: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)	Phenylobacterium zucineum HLK1	Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
CC1110	Caulobacter crescentus CB15 Gene: CC1110: acyl-CoA dehydrogenase family protein	Caulobacter segnis ATCC 21756	Caulobacter sp. K31	Phenylobacterium zucineum HLK1	acyl-CoA dehydrogenase family protein
CC1109	Caulobacter crescentus CB15 Gene: CC1109: COGs COG3777	Caulobacter segnis ATCC 21756	Caulobacter sp. K31	Phenylobacterium zucineum HLK1	COGs COG3777

CRON 20.
fadD2	* Caulobacter crescentus CB15 Site: position = -99 score = 4.9729 sequence = CCTCAAACGCATGTTTGCAT Gene: CC1321: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)	Caulobacter segnis ATCC 21756	* Caulobacter sp. K31 Site: position = -97 score = 4.95619 sequence = GTTCGAACAGACGTTTGCAT Gene: Caul_2153: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)	Phenylobacterium zucineum HLK1 Gene: PHZ_c1345: Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)	Long-chain-fatty-acid--CoA ligase (EC 6.2.1.3)

CRON 21.
Cseg_2255	* Caulobacter crescentus CB15 Site: position = -30 score = 4.82557 sequence = CGCCCAACGAACGTTTGAAT Gene: CC1967: acetyl-CoA acetyltransferase	* Caulobacter segnis ATCC 21756 Site: position = -30 score = 4.85294 sequence = CCCCCAACGATCGTTTGAAT Gene: Cseg_2255: acetyl-CoA acetyltransferase	Caulobacter sp. K31	Phenylobacterium zucineum HLK1 Gene: PHZ_c1574: acetyl-CoA acetyltransferase	acetyl-CoA acetyltransferase
CC1966	Caulobacter crescentus CB15 Gene: CC1966: phosphoglycerate mutase family protein	2 Caulobacter segnis ATCC 21756 Gene: Cseg_1359: phosphoglycerate mutase family protein Gene: Cseg_2254: phosphoglycerate mutase family protein	2 Caulobacter sp. K31 Gene: Caul_2851: phosphoglycerate mutase family protein Gene: Caul_3318: phosphoglycerate mutase family protein	Phenylobacterium zucineum HLK1 Gene: PHZ_c1575: phosphoglycerate mutase family protein	phosphoglycerate mutase family protein
CC1965	Caulobacter crescentus CB15 Gene: CC1965: YjeF protein, function unknown	Caulobacter segnis ATCC 21756 Gene: Cseg_2253: YjeF protein, function unknown	Caulobacter sp. K31 Gene: Caul_2850: YjeF protein, function unknown	Phenylobacterium zucineum HLK1 Gene: PHZ_c1576: YjeF protein, function unknown	YjeF protein, function unknown

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog PsrA - Caulobacterales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --