Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing CC2407 gene

Properties
Regulog: PsrA - Caulobacterales
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Fatty acid degradation
Effector: Oleate
Phylum: Proteobacteria/alpha
Built upon 70 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Caulobacter crescentus CB15
Position: -40
Score: 4.52955
Sequence: CATCTAACAAGTGTTTGATC
Locus tag: CC1111
Name: null
Funciton: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
Locus tag: CC1110
Name: null
Funciton: acyl-CoA dehydrogenase family protein
Locus tag: CC1109
Name: null
Funciton: COGs COG3777
CC1111-CC1110-CC1109 -40 4.5 CATCTAACAAGTGTTTGATC CC1111
Caulobacter sp. K31
Position: -29
Score: 4.98052
Sequence: CGTCAAACATCCGTTCGAGA
Locus tag: Caul_1696
Name: null
Funciton: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
Caul_1696 -29 5 CGTCAAACATCCGTTCGAGA Caul_1696
© 2009-2020 RegPrecise