Statistics of regulated genes

Genome	Genes	Operons
Desulfohalobium retbaense DSM 5692	11	1
Desulfomicrobium baculatum DSM 4028	10	1
Desulfovibrio desulfuricans G20	7	1
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
Desulfovibrio magneticus RS-1
Desulfovibrio piger ATCC 29098
Desulfovibrio salexigens DSM 2638	11	1
Desulfovibrio vulgaris Hildenborough	8	1
Desulfovibrio vulgaris str. Miyazaki F	8	1
Lawsonia intracellularis PHE/MN1-00

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes											Function
CRON 1.
hmcA	* Desulfohalobium retbaense DSM 5692 Site: position = -158 score = 5.06 sequence = TCGCCTACTCAGCCGGTAGGTTT Site: position = -133 score = 5.49097 sequence = ATACCTACCACTGAAGTAGGATT Gene: Dret_0877: High-molecular-weight cytochrome c precursor	* Desulfomicrobium baculatum DSM 4028 Site: position = -194 score = 4.58292 sequence = TTCTATACCTCCGAGGTCGGAAT Gene: Dbac_0568: High-molecular-weight cytochrome c precursor	* Desulfovibrio desulfuricans G20 Site: position = -291 score = 5.99331 sequence = TCGCATACCTCAGCGGTAGGAAA Site: position = -266 score = 5.4984 sequence = AATCATACCATGCAGGTAGGGTA Gene: Dde_0653: High-molecular-weight cytochrome c precursor	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 Gene: Ddes_2038: High-molecular-weight cytochrome c precursor	Desulfovibrio magneticus RS-1 Gene: DMR_12830: High-molecular-weight cytochrome c precursor	Desulfovibrio piger ATCC 29098 Gene: DESPIG_01443: High-molecular-weight cytochrome c precursor	* Desulfovibrio salexigens DSM 2638 Site: position = -176 score = 4.51788 sequence = ATACCAACCCGATGGATGGGAAA Site: position = -201 score = 4.74125 sequence = AAACCTATCTATTGAGGAGGTAT Site: position = -226 score = 5.53272 sequence = TAACATACCTATCGAGCAGGTAT Gene: Desal_1378: High-molecular-weight cytochrome c precursor	* Desulfovibrio vulgaris Hildenborough Site: position = -210 score = 5.82369 sequence = TAGCATACCCCCGCAGTAGGATT Site: position = -185 score = 5.54755 sequence = TTCCATACTATACAGGTAGGGTA Gene: DVU0536: High-molecular-weight cytochrome c precursor	* Desulfovibrio vulgaris str. Miyazaki F Site: position = -346 score = 6.00332 sequence = TCGCATACCCCTCCGGTAGGAAT Site: position = -321 score = 5.915 sequence = TTCCATACCCTAGAAGTAGGGTA Gene: DvMF_2598: High-molecular-weight cytochrome c precursor	Lawsonia intracellularis PHE/MN1-00	High-molecular-weight cytochrome c precursor
hmcB	Desulfohalobium retbaense DSM 5692 Gene: Dret_0876: 4Fe-4S ferredoxin iron-sulfur binding domain protein	Desulfomicrobium baculatum DSM 4028 Gene: Dbac_0569: 4Fe-4S ferredoxin iron-sulfur binding domain protein	Desulfovibrio desulfuricans G20 Gene: Dde_0652: 4Fe-4S ferredoxin iron-sulfur binding domain protein	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 Gene: Ddes_2039: 4Fe-4S ferredoxin iron-sulfur binding domain protein	Desulfovibrio magneticus RS-1 Gene: DMR_12840: 4Fe-4S ferredoxin iron-sulfur binding domain protein	Desulfovibrio piger ATCC 29098 Gene: DESPIG_01442: 4Fe-4S ferredoxin iron-sulfur binding domain protein	Desulfovibrio salexigens DSM 2638 Gene: Desal_1377: 4Fe-4S ferredoxin iron-sulfur binding domain protein	Desulfovibrio vulgaris Hildenborough Gene: DVU0535: 4Fe-4S ferredoxin iron-sulfur binding domain protein	Desulfovibrio vulgaris str. Miyazaki F Gene: DvMF_2597: 4Fe-4S ferredoxin iron-sulfur binding domain protein	Lawsonia intracellularis PHE/MN1-00	4Fe-4S ferredoxin iron-sulfur binding domain protein
hmcC	Desulfohalobium retbaense DSM 5692 Gene: Dret_0875: Ni/Fe-hydrogenase 2 B-type cytochrome subunit	Desulfomicrobium baculatum DSM 4028 Gene: Dbac_0570: Ni/Fe-hydrogenase 2 B-type cytochrome subunit	Desulfovibrio desulfuricans G20 Gene: Dde_0651: Ni/Fe-hydrogenase 2 B-type cytochrome subunit	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 Gene: Ddes_2040: Ni/Fe-hydrogenase 2 B-type cytochrome subunit	Desulfovibrio magneticus RS-1 Gene: DMR_12850: Ni/Fe-hydrogenase 2 B-type cytochrome subunit	Desulfovibrio piger ATCC 29098 Gene: DESPIG_01441: Ni/Fe-hydrogenase 2 B-type cytochrome subunit	Desulfovibrio salexigens DSM 2638 Gene: Desal_1376: Ni/Fe-hydrogenase 2 B-type cytochrome subunit	Desulfovibrio vulgaris Hildenborough Gene: DVU0534: Ni/Fe-hydrogenase 2 B-type cytochrome subunit	Desulfovibrio vulgaris str. Miyazaki F Gene: DvMF_2596: Ni/Fe-hydrogenase 2 B-type cytochrome subunit	Lawsonia intracellularis PHE/MN1-00	Ni/Fe-hydrogenase 2 B-type cytochrome subunit
hmcD	Desulfohalobium retbaense DSM 5692 Gene: Dret_0874: hmc operon protein 4	Desulfomicrobium baculatum DSM 4028 Gene: Dbac_0571: hmc operon protein 4	Desulfovibrio desulfuricans G20 Gene: Dde_0650: hmc operon protein 4	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 Gene: Ddes_2041: hmc operon protein 4	Desulfovibrio magneticus RS-1 Gene: DMR_12860: hmc operon protein 4	Desulfovibrio piger ATCC 29098 Gene: DESPIG_01440: hmc operon protein 4	Desulfovibrio salexigens DSM 2638 Gene: Desal_1375: hmc operon protein 4	Desulfovibrio vulgaris Hildenborough Gene: DVU0533: hmc operon protein 4	Desulfovibrio vulgaris str. Miyazaki F Gene: DvMF_2595: hmc operon protein 4	Lawsonia intracellularis PHE/MN1-00	hmc operon protein 4
hmcE	Desulfohalobium retbaense DSM 5692 Gene: Dret_0873: hmc operon protein 5	Desulfomicrobium baculatum DSM 4028 Gene: Dbac_0572: hmc operon protein 5	Desulfovibrio desulfuricans G20 Gene: Dde_0649: hmc operon protein 5	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 Gene: Ddes_0846: hmc operon protein 5	Desulfovibrio magneticus RS-1 Gene: DMR_12870: hmc operon protein 5	Desulfovibrio piger ATCC 29098	Desulfovibrio salexigens DSM 2638 Gene: Desal_1374: hmc operon protein 5	Desulfovibrio vulgaris Hildenborough Gene: DVU0532: hmc operon protein 5	Desulfovibrio vulgaris str. Miyazaki F Gene: DvMF_2594: hmc operon protein 5	Lawsonia intracellularis PHE/MN1-00	hmc operon protein 5
hmcF	Desulfohalobium retbaense DSM 5692 Gene: Dret_0872: protein of unknown function DUF224 cysteine-rich region domain protein	Desulfomicrobium baculatum DSM 4028 Gene: Dbac_0573: protein of unknown function DUF224 cysteine-rich region domain protein	Desulfovibrio desulfuricans G20 Gene: Dde_0648: protein of unknown function DUF224 cysteine-rich region domain protein	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 Gene: Ddes_0845: protein of unknown function DUF224 cysteine-rich region domain protein	Desulfovibrio magneticus RS-1 Gene: DMR_12880: protein of unknown function DUF224 cysteine-rich region domain protein	Desulfovibrio piger ATCC 29098	Desulfovibrio salexigens DSM 2638 Gene: Desal_1373: protein of unknown function DUF224 cysteine-rich region domain protein	Desulfovibrio vulgaris Hildenborough Gene: DVU0531: protein of unknown function DUF224 cysteine-rich region domain protein	Desulfovibrio vulgaris str. Miyazaki F Gene: DvMF_2593: protein of unknown function DUF224 cysteine-rich region domain protein	Lawsonia intracellularis PHE/MN1-00	protein of unknown function DUF224 cysteine-rich region domain protein
Dret_0871	Desulfohalobium retbaense DSM 5692 Gene: Dret_0871: Universal stress protein family	Desulfomicrobium baculatum DSM 4028 Gene: Dbac_0574: Universal stress protein family	Desulfovibrio desulfuricans G20 Gene: Dde_3712: Universal stress protein family	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774	Desulfovibrio magneticus RS-1 Gene: DMR_12890: Universal stress protein family	Desulfovibrio piger ATCC 29098	Desulfovibrio salexigens DSM 2638 Gene: Desal_1372: Universal stress protein family	Desulfovibrio vulgaris Hildenborough Gene: DVU0261: Universal stress protein family	Desulfovibrio vulgaris str. Miyazaki F Gene: DvMF_2552: Universal stress protein family	Lawsonia intracellularis PHE/MN1-00	Universal stress protein family
mtrA	Desulfohalobium retbaense DSM 5692 Gene: Dret_0870: response regulator receiver protein	Desulfomicrobium baculatum DSM 4028	Desulfovibrio desulfuricans G20 Gene: Dde_3713: Signal transduction response regulator, receiver region	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774	Desulfovibrio magneticus RS-1	Desulfovibrio piger ATCC 29098	Desulfovibrio salexigens DSM 2638 Gene: Desal_1371: response regulator receiver protein	Desulfovibrio vulgaris Hildenborough Gene: DVU0260: Signal transduction response regulator, receiver region	Desulfovibrio vulgaris str. Miyazaki F	Lawsonia intracellularis PHE/MN1-00	Signal transduction response regulator, receiver region
divK	Desulfohalobium retbaense DSM 5692 Gene: Dret_0869: response regulator receiver protein	Desulfomicrobium baculatum DSM 4028 Gene: Dbac_0575: response regulator receiver protein	Desulfovibrio desulfuricans G20 Gene: Dde_3714: response regulator receiver protein	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774	Desulfovibrio magneticus RS-1 Gene: DMR_12900: response regulator receiver protein	Desulfovibrio piger ATCC 29098	Desulfovibrio salexigens DSM 2638 Gene: Desal_1370: response regulator receiver protein	Desulfovibrio vulgaris Hildenborough Gene: DVU0259: response regulator receiver protein	Desulfovibrio vulgaris str. Miyazaki F Gene: DvMF_2551: response regulator receiver protein	Lawsonia intracellularis PHE/MN1-00	response regulator receiver protein
Dbac_0576	Desulfohalobium retbaense DSM 5692 Gene: Dret_0868: multi-sensor signal transduction histidine kinase	Desulfomicrobium baculatum DSM 4028 Gene: Dbac_0576: multi-sensor signal transduction histidine kinase	Desulfovibrio desulfuricans G20 Gene: Dde_3715: multi-sensor signal transduction histidine kinase	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774	Desulfovibrio magneticus RS-1 Gene: DMR_12910: multi-sensor signal transduction histidine kinase	Desulfovibrio piger ATCC 29098	Desulfovibrio salexigens DSM 2638 Gene: Desal_1369: multi-sensor signal transduction histidine kinase	Desulfovibrio vulgaris Hildenborough Gene: DVU0258: multi-sensor signal transduction histidine kinase	Desulfovibrio vulgaris str. Miyazaki F Gene: DvMF_2550: multi-sensor signal transduction histidine kinase	Lawsonia intracellularis PHE/MN1-00	multi-sensor signal transduction histidine kinase
hmcR	Desulfohalobium retbaense DSM 5692 Gene: Dret_0867: Transcriptional regulator, BadM/Rrf2 family	Desulfomicrobium baculatum DSM 4028 Gene: Dbac_0577: Transcriptional regulator, BadM/Rrf2 family	Desulfovibrio desulfuricans G20 Gene: Dde_0647: Transcriptional regulator, BadM/Rrf2 family	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774	Desulfovibrio magneticus RS-1	Desulfovibrio piger ATCC 29098	Desulfovibrio salexigens DSM 2638 Gene: Desal_1368: Transcriptional regulator, BadM/Rrf2 family	Desulfovibrio vulgaris Hildenborough Gene: DVU0529: Transcriptional regulator, BadM/Rrf2 family	Desulfovibrio vulgaris str. Miyazaki F Gene: DvMF_2591: Transcriptional regulator, BadM/Rrf2 family	Lawsonia intracellularis PHE/MN1-00	Transcriptional regulator, BadM/Rrf2 family
rrf1	Desulfohalobium retbaense DSM 5692	Desulfomicrobium baculatum DSM 4028	Desulfovibrio desulfuricans G20	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774	Desulfovibrio magneticus RS-1	Desulfovibrio piger ATCC 29098	Desulfovibrio salexigens DSM 2638	Desulfovibrio vulgaris Hildenborough Gene: DVU0530: response regulator, rrf1 protein	Desulfovibrio vulgaris str. Miyazaki F Gene: DvMF_2592: response regulator, rrf1 protein	Lawsonia intracellularis PHE/MN1-00	response regulator, rrf1 protein

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD