Regulon of HmcR in Desulfohalobium retbaense DSM 5692

Properties
Regulator type:	Transcription factor
TF locus tag:	Dret_0867
Regulator family:	Rrf2
Regulation mode:
Biological process:	Energy metabolism
Effector:
Regulog:	HmcR - Desulfovibrionales
Statistics of regulated genes:
- Genes	11
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - Rrf2
By pathway - Energy metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -158 Score: 5.1 Sequence: TCGCCTACTCAGCCGGTAGGTTT Position: -133 Score: 5.5 Sequence: ATACCTACCACTGAAGTAGGATT Locus tag: Dret_0877 Name: hmcA Funciton: High-molecular-weight cytochrome c precursor Locus tag: Dret_0876 Name: hmcB Funciton: 4Fe-4S ferredoxin iron-sulfur binding domain protein Locus tag: Dret_0875 Name: hmcC Funciton: Ni/Fe-hydrogenase 2 B-type cytochrome subunit Locus tag: Dret_0874 Name: hmcD Funciton: hmc operon protein 4 Locus tag: Dret_0873 Name: hmcE Funciton: hmc operon protein 5 Locus tag: Dret_0872 Name: hmcF Funciton: protein of unknown function DUF224 cysteine-rich region domain protein Locus tag: Dret_0871 Name: null Funciton: Universal stress protein family Locus tag: Dret_0870 Name: null Funciton: response regulator receiver protein Locus tag: Dret_0869 Name: null Funciton: response regulator receiver protein Locus tag: Dret_0868 Name: null Funciton: multi-sensor signal transduction histidine kinase Locus tag: Dret_0867 Name: hmcR Funciton: Transcriptional regulator, BadM/Rrf2 family
	Dret_0877	hmcA	High-molecular-weight cytochrome c precursor
	Dret_0876	hmcB	4Fe-4S ferredoxin iron-sulfur binding domain protein
	Dret_0875	hmcC	Ni/Fe-hydrogenase 2 B-type cytochrome subunit
	Dret_0874	hmcD	hmc operon protein 4
	Dret_0873	hmcE	hmc operon protein 5
	Dret_0872	hmcF	protein of unknown function DUF224 cysteine-rich region domain protein
	Dret_0871		Universal stress protein family
	Dret_0870		response regulator receiver protein
	Dret_0869		response regulator receiver protein
	Dret_0868		multi-sensor signal transduction histidine kinase
	Dret_0867	hmcR	Transcriptional regulator, BadM/Rrf2 family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD