Regulon of HmcR in Desulfovibrio vulgaris str. Miyazaki F

Properties
Regulator type:	Transcription factor
TF locus tag:	DvMF_2591
Regulator family:	Rrf2
Regulation mode:
Biological process:	Energy metabolism
Effector:
Regulog:	HmcR - Desulfovibrionales
Statistics of regulated genes:
- Genes	8
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - Rrf2
By pathway - Energy metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -346 Score: 6 Sequence: TCGCATACCCCTCCGGTAGGAAT Position: -321 Score: 5.9 Sequence: TTCCATACCCTAGAAGTAGGGTA Locus tag: DvMF_2598 Name: hmcA Funciton: High-molecular-weight cytochrome c precursor Locus tag: DvMF_2597 Name: hmcB Funciton: 4Fe-4S ferredoxin iron-sulfur binding domain protein Locus tag: DvMF_2596 Name: hmcC Funciton: Ni/Fe-hydrogenase 2 B-type cytochrome subunit Locus tag: DvMF_2595 Name: hmcD Funciton: hmc operon protein 4 Locus tag: DvMF_2594 Name: hmcE Funciton: hmc operon protein 5 Locus tag: DvMF_2593 Name: hmcF Funciton: protein of unknown function DUF224 cysteine-rich region domain protein Locus tag: DvMF_2592 Name: null Funciton: response regulator, rrf1 protein Locus tag: DvMF_2591 Name: hmcR Funciton: Transcriptional regulator, BadM/Rrf2 family
	DvMF_2598	hmcA	High-molecular-weight cytochrome c precursor
	DvMF_2597	hmcB	4Fe-4S ferredoxin iron-sulfur binding domain protein
	DvMF_2596	hmcC	Ni/Fe-hydrogenase 2 B-type cytochrome subunit
	DvMF_2595	hmcD	hmc operon protein 4
	DvMF_2594	hmcE	hmc operon protein 5
	DvMF_2593	hmcF	protein of unknown function DUF224 cysteine-rich region domain protein
	DvMF_2592		response regulator, rrf1 protein
	DvMF_2591	hmcR	Transcriptional regulator, BadM/Rrf2 family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD