Regulon of HmcR in Desulfovibrio desulfuricans G20

Properties
Regulator type:	Transcription factor
TF locus tag:	Dde_0647
Regulator family:	Rrf2
Regulation mode:
Biological process:	Energy metabolism
Effector:
Regulog:	HmcR - Desulfovibrionales
Statistics of regulated genes:
- Genes	7
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - Rrf2
By pathway - Energy metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -291 Score: 6 Sequence: TCGCATACCTCAGCGGTAGGAAA Position: -266 Score: 5.5 Sequence: AATCATACCATGCAGGTAGGGTA Locus tag: Dde_0653 Name: hmcA Funciton: High-molecular-weight cytochrome c precursor Locus tag: Dde_0652 Name: hmcB Funciton: 4Fe-4S ferredoxin iron-sulfur binding domain protein Locus tag: Dde_0651 Name: hmcC Funciton: Ni/Fe-hydrogenase 2 B-type cytochrome subunit Locus tag: Dde_0650 Name: hmcD Funciton: hmc operon protein 4 Locus tag: Dde_0649 Name: hmcE Funciton: hmc operon protein 5 Locus tag: Dde_0648 Name: hmcF Funciton: protein of unknown function DUF224 cysteine-rich region domain protein Locus tag: Dde_0647 Name: hmcR Funciton: Transcriptional regulator, BadM/Rrf2 family
	Dde_0653	hmcA	High-molecular-weight cytochrome c precursor
	Dde_0652	hmcB	4Fe-4S ferredoxin iron-sulfur binding domain protein
	Dde_0651	hmcC	Ni/Fe-hydrogenase 2 B-type cytochrome subunit
	Dde_0650	hmcD	hmc operon protein 4
	Dde_0649	hmcE	hmc operon protein 5
	Dde_0648	hmcF	protein of unknown function DUF224 cysteine-rich region domain protein
	Dde_0647	hmcR	Transcriptional regulator, BadM/Rrf2 family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD