Regulon of HmcR in Desulfomicrobium baculatum DSM 4028

Properties
Regulator type:	Transcription factor
TF locus tag:	Dbac_0577
Regulator family:	Rrf2
Regulation mode:
Biological process:	Energy metabolism
Effector:
Regulog:	HmcR - Desulfovibrionales
Statistics of regulated genes:
- Genes	10
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - Rrf2
By pathway - Energy metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -194 Score: 4.6 Sequence: TTCTATACCTCCGAGGTCGGAAT Locus tag: Dbac_0568 Name: hmcA Funciton: High-molecular-weight cytochrome c precursor Locus tag: Dbac_0569 Name: hmcB Funciton: 4Fe-4S ferredoxin iron-sulfur binding domain protein Locus tag: Dbac_0570 Name: hmcC Funciton: Ni/Fe-hydrogenase 2 B-type cytochrome subunit Locus tag: Dbac_0571 Name: hmcD Funciton: hmc operon protein 4 Locus tag: Dbac_0572 Name: hmcE Funciton: hmc operon protein 5 Locus tag: Dbac_0573 Name: hmcF Funciton: protein of unknown function DUF224 cysteine-rich region domain protein Locus tag: Dbac_0574 Name: null Funciton: Universal stress protein family Locus tag: Dbac_0575 Name: null Funciton: response regulator receiver protein Locus tag: Dbac_0576 Name: null Funciton: multi-sensor signal transduction histidine kinase Locus tag: Dbac_0577 Name: hmcR Funciton: Transcriptional regulator, BadM/Rrf2 family
	Dbac_0568	hmcA	High-molecular-weight cytochrome c precursor
	Dbac_0569	hmcB	4Fe-4S ferredoxin iron-sulfur binding domain protein
	Dbac_0570	hmcC	Ni/Fe-hydrogenase 2 B-type cytochrome subunit
	Dbac_0571	hmcD	hmc operon protein 4
	Dbac_0572	hmcE	hmc operon protein 5
	Dbac_0573	hmcF	protein of unknown function DUF224 cysteine-rich region domain protein
	Dbac_0574		Universal stress protein family
	Dbac_0575		response regulator receiver protein
	Dbac_0576		multi-sensor signal transduction histidine kinase
	Dbac_0577	hmcR	Transcriptional regulator, BadM/Rrf2 family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD