Regulon of HmcR in Desulfomicrobium baculatum DSM 4028
| Regulator type: | Transcription factor |
| TF locus tag: | Dbac_0577 |
| Regulator family: | Rrf2 |
| Regulation mode: | |
| Biological process: | Energy metabolism |
| Effector: | |
| Regulog: | HmcR - Desulfovibrionales |
| Statistics of regulated genes: | |
| - Genes | 10 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Desulfovibrionales
- By TF family - Rrf2
- By pathway - Energy metabolism
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -194
Score: 4.6 Sequence: TTCTATACCTCCGAGGTCGGAAT
Locus tag: Dbac_0568
Name: hmcA Funciton: High-molecular-weight cytochrome c precursor
Locus tag: Dbac_0569
Name: hmcB Funciton: 4Fe-4S ferredoxin iron-sulfur binding domain protein
Locus tag: Dbac_0570
Name: hmcC Funciton: Ni/Fe-hydrogenase 2 B-type cytochrome subunit
Locus tag: Dbac_0571
Name: hmcD Funciton: hmc operon protein 4
Locus tag: Dbac_0572
Name: hmcE Funciton: hmc operon protein 5
Locus tag: Dbac_0573
Name: hmcF Funciton: protein of unknown function DUF224 cysteine-rich region domain protein
Locus tag: Dbac_0574
Name: null Funciton: Universal stress protein family
Locus tag: Dbac_0575
Name: null Funciton: response regulator receiver protein
Locus tag: Dbac_0576
Name: null Funciton: multi-sensor signal transduction histidine kinase
Locus tag: Dbac_0577
Name: hmcR Funciton: Transcriptional regulator, BadM/Rrf2 family |
|||
|
hmcA
|
High-molecular-weight cytochrome c precursor
|
||
|
hmcB
|
4Fe-4S ferredoxin iron-sulfur binding domain protein
|
||
|
hmcC
|
Ni/Fe-hydrogenase 2 B-type cytochrome subunit
|
||
|
hmcD
|
hmc operon protein 4
|
||
|
hmcE
|
hmc operon protein 5
|
||
|
hmcF
|
protein of unknown function DUF224 cysteine-rich region domain protein
|
||
|
Universal stress protein family
|
|||
|
response regulator receiver protein
|
|||
|
multi-sensor signal transduction histidine kinase
|
|||
|
hmcR
|
Transcriptional regulator, BadM/Rrf2 family
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |