Regulon of HmcR in Desulfovibrio salexigens DSM 2638

Properties
Regulator type:	Transcription factor
TF locus tag:	Desal_1368
Regulator family:	Rrf2
Regulation mode:
Biological process:	Energy metabolism
Effector:
Regulog:	HmcR - Desulfovibrionales
Statistics of regulated genes:
- Genes	11
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - Rrf2
By pathway - Energy metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -226 Score: 5.5 Sequence: TAACATACCTATCGAGCAGGTAT Position: -201 Score: 4.7 Sequence: AAACCTATCTATTGAGGAGGTAT Position: -176 Score: 4.5 Sequence: ATACCAACCCGATGGATGGGAAA Locus tag: Desal_1378 Name: hmcA Funciton: High-molecular-weight cytochrome c precursor Locus tag: Desal_1377 Name: hmcB Funciton: 4Fe-4S ferredoxin iron-sulfur binding domain protein Locus tag: Desal_1376 Name: hmcC Funciton: Ni/Fe-hydrogenase 2 B-type cytochrome subunit Locus tag: Desal_1375 Name: hmcD Funciton: hmc operon protein 4 Locus tag: Desal_1374 Name: hmcE Funciton: hmc operon protein 5 Locus tag: Desal_1373 Name: hmcF Funciton: protein of unknown function DUF224 cysteine-rich region domain protein Locus tag: Desal_1372 Name: null Funciton: Universal stress protein family Locus tag: Desal_1371 Name: null Funciton: response regulator receiver protein Locus tag: Desal_1370 Name: null Funciton: response regulator receiver protein Locus tag: Desal_1369 Name: null Funciton: multi-sensor signal transduction histidine kinase Locus tag: Desal_1368 Name: hmcR Funciton: Transcriptional regulator, BadM/Rrf2 family
	Desal_1378	hmcA	High-molecular-weight cytochrome c precursor
	Desal_1377	hmcB	4Fe-4S ferredoxin iron-sulfur binding domain protein
	Desal_1376	hmcC	Ni/Fe-hydrogenase 2 B-type cytochrome subunit
	Desal_1375	hmcD	hmc operon protein 4
	Desal_1374	hmcE	hmc operon protein 5
	Desal_1373	hmcF	protein of unknown function DUF224 cysteine-rich region domain protein
	Desal_1372		Universal stress protein family
	Desal_1371		response regulator receiver protein
	Desal_1370		response regulator receiver protein
	Desal_1369		multi-sensor signal transduction histidine kinase
	Desal_1368	hmcR	Transcriptional regulator, BadM/Rrf2 family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD