Regulon of HmcR in Desulfovibrio vulgaris Hildenborough

Properties
Regulator type:	Transcription factor
TF locus tag:	DVU0529
Regulator family:	Rrf2
Regulation mode:
Biological process:	Energy metabolism
Effector:
Regulog:	HmcR - Desulfovibrionales
Statistics of regulated genes:
- Genes	8
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - Rrf2
By pathway - Energy metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -210 Score: 5.8 Sequence: TAGCATACCCCCGCAGTAGGATT Position: -185 Score: 5.5 Sequence: TTCCATACTATACAGGTAGGGTA Locus tag: DVU0536 Name: hmcA Funciton: High-molecular-weight cytochrome c precursor Locus tag: DVU0535 Name: hmcB Funciton: 4Fe-4S ferredoxin iron-sulfur binding domain protein Locus tag: DVU0534 Name: hmcC Funciton: Ni/Fe-hydrogenase 2 B-type cytochrome subunit Locus tag: DVU0533 Name: hmcD Funciton: hmc operon protein 4 Locus tag: DVU0532 Name: hmcE Funciton: hmc operon protein 5 Locus tag: DVU0531 Name: hmcF Funciton: protein of unknown function DUF224 cysteine-rich region domain protein Locus tag: DVU0530 Name: rrf1 Funciton: response regulator, rrf1 protein Locus tag: DVU0529 Name: hmcR Funciton: Transcriptional regulator, BadM/Rrf2 family
	DVU0536	hmcA	High-molecular-weight cytochrome c precursor
	DVU0535	hmcB	4Fe-4S ferredoxin iron-sulfur binding domain protein
	DVU0534	hmcC	Ni/Fe-hydrogenase 2 B-type cytochrome subunit
	DVU0533	hmcD	hmc operon protein 4
	DVU0532	hmcE	hmc operon protein 5
	DVU0531	hmcF	protein of unknown function DUF224 cysteine-rich region domain protein
	DVU0530	rrf1	response regulator, rrf1 protein
	DVU0529	hmcR	Transcriptional regulator, BadM/Rrf2 family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD