Regulog DVU1964/DVU1967 - Desulfovibrionales
| Regulator type: | Transcription factor |
| Regulator family: | Rrf2 |
| Regulation mode: | |
| Biological process: | |
| Effector: | |
| Phylum: | Proteobacteria/delta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Desulfovibrionales
- By TF family - Rrf2
| Genome | Genes | Operons |
|---|---|---|
| Desulfohalobium retbaense DSM 5692 | ||
| Desulfomicrobium baculatum DSM 4028 | 1 | 1 |
| Desulfovibrio desulfuricans G20 | 4 | 1 |
| Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 | 4 | 2 |
| Desulfovibrio magneticus RS-1 | ||
| Desulfovibrio piger ATCC 29098 | ||
| Desulfovibrio salexigens DSM 2638 | 5 | 2 |
| Desulfovibrio vulgaris Hildenborough | 4 | 1 |
| Desulfovibrio vulgaris str. Miyazaki F | 4 | 1 |
| Lawsonia intracellularis PHE/MN1-00 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| Dbac_3187 |
|
*
Desulfomicrobium baculatum DSM 4028 Site: position = -17 score = 4.38081 sequence = AATCATTCGAGATTATTATGAAG Gene: Dbac_3187: Transcriptional regulator, Rrf2 family |
Gene: Dde_3112: Transcriptional regulator, Rrf2 family |
|
|
|
*
Desulfovibrio salexigens DSM 2638 Site: position = -269 score = 4.0991 sequence = TTAAATATCAACGCAATATGTAG Gene: Desal_0351: Transcriptional regulator, Rrf2 family |
|
|
|
Transcriptional regulator, Rrf2 family |
| CRON 2. | |||||||||||
| Desal_0350 |
|
|
Gene: Dde_2176: FAD-dependent pyridine nucleotide-disulphide oxidoreductase |
|
|
|
*
Desulfovibrio salexigens DSM 2638 Site: position = -585 score = 5.61709 sequence = ATTCAGATTAATTTAATCCGAAT Site: position = -570 score = 4.77215 sequence = ATCCGAATTAAAACAATCTGAAT Site: position = -491 score = 5.17011 sequence = TTCTAGACTTATTTAATCTAGAT Site: position = -476 score = 5.08174 sequence = ATCTAGATTAAAACAATCAGAAA Gene: Desal_0350: FAD-dependent pyridine nucleotide-disulphide oxidoreductase |
Gene: DVU1368: FAD-dependent pyridine nucleotide-disulphide oxidoreductase |
Gene: DvMF_0145: FAD-dependent pyridine nucleotide-disulphide oxidoreductase |
|
FAD-dependent pyridine nucleotide-disulphide oxidoreductase |
| DVU1968 |
|
|
Gene: Dde_0223: FAD-dependent pyridine nucleotide-disulphide oxidoreductase |
*
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 Site: position = -196 score = 4.7697 sequence = AAACATACTAGTTTAGTATTAAT Gene: Ddes_1846: FAD-dependent pyridine nucleotide-disulphide oxidoreductase |
Gene: DMR_13140: FAD-dependent pyridine nucleotide-disulphide oxidoreductase |
|
Gene: Desal_0349: FAD-dependent pyridine nucleotide-disulphide oxidoreductase |
Gene: DVU1968: FAD-dependent pyridine nucleotide-disulphide oxidoreductase |
Gene: DvMF_0624: FAD-dependent pyridine nucleotide-disulphide oxidoreductase |
|
FAD-dependent pyridine nucleotide-disulphide oxidoreductase |
| DVU1969 |
|
|
Gene: Dde_0222: hypothetical protein |
Gene: Ddes_1847: hypothetical protein |
Gene: DMR_13130: hypothetical protein |
|
Gene: Desal_0348: hypothetical protein |
Gene: DVU1969: hypothetical protein |
Gene: DvMF_0625: hypothetical protein |
|
hypothetical protein |
| DVU1970 |
|
|
Gene: Dde_0221: response regulator receiver protein |
Gene: Ddes_0844: response regulator receiver protein |
Gene: DMR_13120: response regulator receiver protein |
|
Gene: Desal_0347: response regulator receiver protein |
Gene: DVU1970: response regulator receiver protein |
Gene: DvMF_0626: response regulator receiver protein |
|
response regulator receiver protein |
| DVU1967 |
|
|
*
Desulfovibrio desulfuricans G20 Site: position = -79 score = 4.70932 sequence = ATCTAGATAAATTAAATCCGCTT Site: position = -139 score = 5.63852 sequence = AATCAGACCAAACAAGTCTGGAT Site: position = -94 score = 5.53241 sequence = ATCCAGACTGTATTAATCTAGAT Gene: Dde_0224: Transcriptional regulator, Rrf2 family |
*
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 Site: position = -77 score = 4.68226 sequence = ATCATGAGTAAAGCAGTCTAAAT Site: position = -57 score = 4.5924 sequence = AATTAGACGTATCAAGTATGGTA Gene: Ddes_0843: Transcriptional regulator, Rrf2 family |
|
|
|
*
Desulfovibrio vulgaris Hildenborough Site: position = -104 score = 5.80736 sequence = ATTCAGACCAACTCAATCTGATA Site: position = -84 score = 4.76089 sequence = ATACAGATTAATTAAGATTGAAA Gene: DVU1967: Transcriptional regulator, Rrf2 family |
*
Desulfovibrio vulgaris str. Miyazaki F Site: position = -155 score = 5.94012 sequence = ATTCATACGAAATTAATCTGATT Site: position = -110 score = 4.06798 sequence = AACGAAATTGCATCAATATACAT Gene: DvMF_0623: Transcriptional regulator, Rrf2 family |
|
Transcriptional regulator, Rrf2 family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |