Regulon of DVU1964/DVU1967 in Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Properties
Regulator type:	Transcription factor
TF locus tag:	Ddes_0843, Ddes_0842
Regulator family:	Rrf2
Regulation mode:
Biological process:
Effector:
Regulog:	DVU1964/DVU1967 - Desulfovibrionales
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - Rrf2

Regulated operons
	Locus Tag	Name	Function
Position: -196 Score: 4.8 Sequence: AAACATACTAGTTTAGTATTAAT Locus tag: Ddes_1846 Name: null Funciton: FAD-dependent pyridine nucleotide-disulphide oxidoreductase Locus tag: Ddes_1847 Name: null Funciton: hypothetical protein
	Ddes_1846		FAD-dependent pyridine nucleotide-disulphide oxidoreductase
	Ddes_1847		hypothetical protein
Position: -77 Score: 4.7 Sequence: ATCATGAGTAAAGCAGTCTAAAT Position: -57 Score: 4.6 Sequence: AATTAGACGTATCAAGTATGGTA Locus tag: Ddes_0843 Name: DVU1967 Funciton: Transcriptional regulator, Rrf2 family Locus tag: Ddes_0844 Name: null Funciton: response regulator receiver protein
	Ddes_0843	DVU1967	Transcriptional regulator, Rrf2 family
	Ddes_0844		response regulator receiver protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD