Regulon of DVU1964/DVU1967 in Desulfomicrobium baculatum DSM 4028

Properties
Regulator type:	Transcription factor
TF locus tag:	Dbac_3187
Regulator family:	Rrf2
Regulation mode:
Biological process:
Effector:
Regulog:	DVU1964/DVU1967 - Desulfovibrionales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - Rrf2

Regulated operons
	Locus Tag	Name	Function
Position: -17 Score: 4.4 Sequence: AATCATTCGAGATTATTATGAAG Locus tag: Dbac_3187 Name: Dbac_3187 Funciton: Transcriptional regulator, Rrf2 family
	Dbac_3187	Dbac_3187	Transcriptional regulator, Rrf2 family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD