Regulon of DVU1964/DVU1967 in Desulfovibrio salexigens DSM 2638

Properties
Regulator type:	Transcription factor
TF locus tag:	Desal_0351
Regulator family:	Rrf2
Regulation mode:
Biological process:
Effector:
Regulog:	DVU1964/DVU1967 - Desulfovibrionales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - Rrf2

Regulated operons
	Locus Tag	Name	Function
Position: -585 Score: 5.6 Sequence: ATTCAGATTAATTTAATCCGAAT Position: -570 Score: 4.8 Sequence: ATCCGAATTAAAACAATCTGAAT Position: -491 Score: 5.2 Sequence: TTCTAGACTTATTTAATCTAGAT Position: -476 Score: 5.1 Sequence: ATCTAGATTAAAACAATCAGAAA Locus tag: Desal_0350 Name: null Funciton: FAD-dependent pyridine nucleotide-disulphide oxidoreductase Locus tag: Desal_0349 Name: null Funciton: FAD-dependent pyridine nucleotide-disulphide oxidoreductase Locus tag: Desal_0348 Name: null Funciton: hypothetical protein Locus tag: Desal_0347 Name: null Funciton: response regulator receiver protein
	Desal_0350		FAD-dependent pyridine nucleotide-disulphide oxidoreductase
	Desal_0349		FAD-dependent pyridine nucleotide-disulphide oxidoreductase
	Desal_0348		hypothetical protein
	Desal_0347		response regulator receiver protein
Position: -269 Score: 4.1 Sequence: TTAAATATCAACGCAATATGTAG Locus tag: Desal_0351 Name: Dbac_3187 Funciton: Transcriptional regulator, Rrf2 family
	Desal_0351	Dbac_3187	Transcriptional regulator, Rrf2 family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD