Regulon of DVU1964/DVU1967 in Desulfovibrio desulfuricans G20

Properties
Regulator type:	Transcription factor
TF locus tag:	Dde_3112, Dde_0224, Dde_0235
Regulator family:	Rrf2
Regulation mode:
Biological process:
Effector:
Regulog:	DVU1964/DVU1967 - Desulfovibrionales
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - Rrf2

Regulated operons
	Locus Tag	Name	Function
Position: -139 Score: 5.6 Sequence: AATCAGACCAAACAAGTCTGGAT Position: -94 Score: 5.5 Sequence: ATCCAGACTGTATTAATCTAGAT Position: -79 Score: 4.7 Sequence: ATCTAGATAAATTAAATCCGCTT Locus tag: Dde_0224 Name: DVU1967 Funciton: Transcriptional regulator, Rrf2 family Locus tag: Dde_0223 Name: null Funciton: FAD-dependent pyridine nucleotide-disulphide oxidoreductase Locus tag: Dde_0222 Name: null Funciton: hypothetical protein Locus tag: Dde_0221 Name: null Funciton: response regulator receiver protein
	Dde_0224	DVU1967	Transcriptional regulator, Rrf2 family
	Dde_0223		FAD-dependent pyridine nucleotide-disulphide oxidoreductase
	Dde_0222		hypothetical protein
	Dde_0221		response regulator receiver protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD