Regulon of DVU1964/DVU1967 in Desulfovibrio vulgaris Hildenborough

Properties
Regulator type:	Transcription factor
TF locus tag:	DVU1967, DVU1964
Regulator family:	Rrf2
Regulation mode:
Biological process:
Effector:
Regulog:	DVU1964/DVU1967 - Desulfovibrionales
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - Rrf2

Regulated operons
	Locus Tag	Name	Function
Position: -104 Score: 5.8 Sequence: ATTCAGACCAACTCAATCTGATA Position: -84 Score: 4.8 Sequence: ATACAGATTAATTAAGATTGAAA Locus tag: DVU1967 Name: DVU1967 Funciton: Transcriptional regulator, Rrf2 family Locus tag: DVU1968 Name: null Funciton: FAD-dependent pyridine nucleotide-disulphide oxidoreductase Locus tag: DVU1969 Name: null Funciton: hypothetical protein Locus tag: DVU1970 Name: null Funciton: response regulator receiver protein
	DVU1967	DVU1967	Transcriptional regulator, Rrf2 family
	DVU1968		FAD-dependent pyridine nucleotide-disulphide oxidoreductase
	DVU1969		hypothetical protein
	DVU1970		response regulator receiver protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD