Regulon of DVU1964/DVU1967 in Desulfovibrio vulgaris str. Miyazaki F

Properties
Regulator type:	Transcription factor
TF locus tag:	DvMF_0623, DvMF_0622
Regulator family:	Rrf2
Regulation mode:
Biological process:
Effector:
Regulog:	DVU1964/DVU1967 - Desulfovibrionales
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - Rrf2

Regulated operons
	Locus Tag	Name	Function
Position: -155 Score: 5.9 Sequence: ATTCATACGAAATTAATCTGATT Position: -110 Score: 4.1 Sequence: AACGAAATTGCATCAATATACAT Locus tag: DvMF_0623 Name: DVU1967 Funciton: Transcriptional regulator, Rrf2 family Locus tag: DvMF_0624 Name: null Funciton: FAD-dependent pyridine nucleotide-disulphide oxidoreductase Locus tag: DvMF_0625 Name: null Funciton: hypothetical protein Locus tag: DvMF_0626 Name: null Funciton: response regulator receiver protein
	DvMF_0623	DVU1967	Transcriptional regulator, Rrf2 family
	DvMF_0624		FAD-dependent pyridine nucleotide-disulphide oxidoreductase
	DvMF_0625		hypothetical protein
	DvMF_0626		response regulator receiver protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD