Regulog IscR - Pseudomonadaceae

Properties
Regulator type:	Transcription factor
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Phylum:	Proteobacteria
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Statistics of regulated genes
Genome	Genes	Operons
Pseudomonas aeruginosa PAO1	9	2
Pseudomonas entomophila L48	9	2
Pseudomonas putida KT2440	9	2
Pseudomonas syringae pv. tomato str. DC3000	9	2
Pseudomonas fluorescens Pf-5	9	2
Pseudomonas mendocina ymp	9	2
Pseudomonas stutzeri A1501	9	2
Azotobacter vinelandii AvOP	8	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes									Function

CRON 1.
iscR	* Pseudomonas aeruginosa PAO1 Site: position = -71 score = 7.11054 sequence = ATAGTTGACCTAATTACTCGGATAA Gene: PA3815: Iron-sulfur cluster regulator IscR	* Pseudomonas entomophila L48 Site: position = -70 score = 7.00091 sequence = ATAGTTGACTTAAATGCTCGGGAAT Gene: PSEEN1009: Iron-sulfur cluster regulator IscR	* Pseudomonas putida KT2440 Site: position = -70 score = 7.00091 sequence = ATAGTTGACTTAAATGCTCGGGAAT Gene: PP0841: Iron-sulfur cluster regulator IscR	* Pseudomonas syringae pv. tomato str. DC3000 Site: position = -65 score = 7.12008 sequence = ATAGTTGACTAATTTGCTCGGGAAT Gene: PSPTO1422: Iron-sulfur cluster regulator IscR	* Pseudomonas fluorescens Pf-5 Site: position = -66 score = 6.96814 sequence = ATAGTTGACCTGATTACTCGGGTAT Gene: PFL_4966: Iron-sulfur cluster regulator IscR	* Pseudomonas mendocina ymp Site: position = -64 score = 7.04009 sequence = ATAGTTGACTTAAATACTCGGGAAT Gene: Pmen_3512: Iron-sulfur cluster regulator IscR	* Pseudomonas stutzeri A1501 Site: position = -4 score = 6.91741 sequence = ATAGTTGACTCAAATACTCGGGAAT Gene: PST_3043: Iron-sulfur cluster regulator IscR	* Azotobacter vinelandii AvOP Site: position = -65 score = 6.10082 sequence = ATAGTTGATCCTGTTTGTCGGGTAT Gene: Avin_40410: Iron-sulfur cluster regulator IscR	Iron-sulfur cluster regulator IscR
iscS	Pseudomonas aeruginosa PAO1 Gene: PA3814: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Pseudomonas entomophila L48 Gene: PSEEN1010: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Pseudomonas putida KT2440 Gene: PP0842: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO1423: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Pseudomonas fluorescens Pf-5 Gene: PFL_4965: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Pseudomonas mendocina ymp Gene: Pmen_3511: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Pseudomonas stutzeri A1501 Gene: PST_3042: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Azotobacter vinelandii AvOP Gene: Avin_40400: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
iscU	Pseudomonas aeruginosa PAO1 Gene: PA3813: Iron-sulfur cluster assembly scaffold protein IscU	Pseudomonas entomophila L48 Gene: PSEEN1011: Iron-sulfur cluster assembly scaffold protein IscU	Pseudomonas putida KT2440 Gene: PP0843: Iron-sulfur cluster assembly scaffold protein IscU	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO1424: Iron-sulfur cluster assembly scaffold protein IscU	Pseudomonas fluorescens Pf-5 Gene: PFL_4964: Iron-sulfur cluster assembly scaffold protein IscU	Pseudomonas mendocina ymp Gene: Pmen_3510: Iron-sulfur cluster assembly scaffold protein IscU	Pseudomonas stutzeri A1501 Gene: PST_3041: Iron-sulfur cluster assembly scaffold protein IscU	Azotobacter vinelandii AvOP Gene: Avin_40390: Iron-sulfur cluster assembly scaffold protein IscU	Iron-sulfur cluster assembly scaffold protein IscU
iscA	Pseudomonas aeruginosa PAO1 Gene: PA3812: Iron binding protein IscA for iron-sulfur cluster assembly	Pseudomonas entomophila L48 Gene: PSEEN1012: Iron binding protein IscA for iron-sulfur cluster assembly	Pseudomonas putida KT2440 Gene: PP0844: Iron binding protein IscA for iron-sulfur cluster assembly	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO1425: Iron binding protein IscA for iron-sulfur cluster assembly	Pseudomonas fluorescens Pf-5 Gene: PFL_4963: Iron binding protein IscA for iron-sulfur cluster assembly	Pseudomonas mendocina ymp Gene: Pmen_3509: Iron binding protein IscA for iron-sulfur cluster assembly	Pseudomonas stutzeri A1501 Gene: PST_3040: Iron binding protein IscA for iron-sulfur cluster assembly	Azotobacter vinelandii AvOP Gene: Avin_40380: Iron binding protein IscA for iron-sulfur cluster assembly	Iron binding protein IscA for iron-sulfur cluster assembly
hscB	Pseudomonas aeruginosa PAO1 Gene: PA3811: Chaperone protein HscB	Pseudomonas entomophila L48 Gene: PSEEN1013: Chaperone protein HscB	Pseudomonas putida KT2440 Gene: PP0845: Chaperone protein HscB	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO1426: Chaperone protein HscB	Pseudomonas fluorescens Pf-5 Gene: PFL_4962: Chaperone protein HscB	Pseudomonas mendocina ymp Gene: Pmen_3508: Chaperone protein HscB	Pseudomonas stutzeri A1501 Gene: PST_3039: Chaperone protein HscB	Azotobacter vinelandii AvOP Gene: Avin_40370: Chaperone protein HscB	Chaperone protein HscB
hscA	Pseudomonas aeruginosa PAO1 Gene: PA3810: Chaperone protein HscA	Pseudomonas entomophila L48 Gene: PSEEN1014: Chaperone protein HscA	Pseudomonas putida KT2440 Gene: PP0846: Chaperone protein HscA	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO1427: Chaperone protein HscA	Pseudomonas fluorescens Pf-5 Gene: PFL_4961: Chaperone protein HscA	Pseudomonas mendocina ymp Gene: Pmen_3507: Chaperone protein HscA	Pseudomonas stutzeri A1501 Gene: PST_3038: Chaperone protein HscA	Azotobacter vinelandii AvOP Gene: Avin_40360: Chaperone protein HscA	Chaperone protein HscA
fdx	Pseudomonas aeruginosa PAO1 Gene: PA3809: ferredoxin, 2Fe-2S type, ISC system	Pseudomonas entomophila L48 Gene: PSEEN1015: ferredoxin, 2Fe-2S type, ISC system	Pseudomonas putida KT2440 Gene: PP0847: ferredoxin, 2Fe-2S type, ISC system	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO1428: ferredoxin, 2Fe-2S type, ISC system	Pseudomonas fluorescens Pf-5 Gene: PFL_4960: ferredoxin, 2Fe-2S type, ISC system	Pseudomonas mendocina ymp Gene: Pmen_3506: ferredoxin, 2Fe-2S type, ISC system	Pseudomonas stutzeri A1501 Gene: PST_3037: ferredoxin, 2Fe-2S type, ISC system	Azotobacter vinelandii AvOP Gene: Avin_40350: ferredoxin, 2Fe-2S type, ISC system	ferredoxin, 2Fe-2S type, ISC system
yfhJ	Pseudomonas aeruginosa PAO1 Gene: PA3808: putative Fe-S cluster assembly protein	Pseudomonas entomophila L48 Gene: PSEEN1016: putative Fe-S cluster assembly protein	Pseudomonas putida KT2440 Gene: PP0848: putative Fe-S cluster assembly protein	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO1429: putative Fe-S cluster assembly protein	Pseudomonas fluorescens Pf-5 Gene: PFL_4959: putative Fe-S cluster assembly protein	Pseudomonas mendocina ymp Gene: Pmen_3505: putative Fe-S cluster assembly protein	Pseudomonas stutzeri A1501 Gene: PST_3036: putative Fe-S cluster assembly protein	Azotobacter vinelandii AvOP Gene: Avin_40340: putative Fe-S cluster assembly protein	putative Fe-S cluster assembly protein

CRON 2.
erpA	* Pseudomonas aeruginosa PAO1 Site: position = -81 score = 6.35212 sequence = TTAGTTGACCATTTTTCTGGGACAA Gene: PA0665: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Pseudomonas entomophila L48 Site: position = -79 score = 6.72428 sequence = ATTCTTGACCGATTTTCTCGGAGAA Gene: PSEEN0461: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Pseudomonas putida KT2440 Site: position = -32 score = 6.92285 sequence = ATTCTTGACCGATTTTCTCGGGAAA Gene: PP0433: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Pseudomonas syringae pv. tomato str. DC3000 Site: position = -93 score = 6.92263 sequence = ATAGTTGACCGATTTTCTAGGAGAA Gene: PSPTO0605: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Pseudomonas fluorescens Pf-5 Site: position = -81 score = 6.69818 sequence = ATAGTTGACCGCTTTTCTGGGAGAA Gene: PFL_5610: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Pseudomonas mendocina ymp Site: position = -77 score = 7.28377 sequence = ATAGTTGACCAATTTTCTCGGGCAA Gene: Pmen_3930: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Pseudomonas stutzeri A1501 Site: position = -76 score = 6.51231 sequence = ATAGTTGACCGGTTTTGTCAGGCAA Gene: PST_0755: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	Azotobacter vinelandii AvOP Gene: Avin_46030: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog IscR - Pseudomonadaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --