Regulon of IscR in Pseudomonas aeruginosa PAO1

Properties
Regulator type:	Transcription factor
TF locus tag:	PA3815
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Pseudomonadaceae
Statistics of regulated genes:
- Genes	9
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -71 Score: 7.1 Sequence: ATAGTTGACCTAATTACTCGGATAA Locus tag: PA3815 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: PA3814 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: PA3813 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: PA3812 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: PA3811 Name: hscB Funciton: Chaperone protein HscB Locus tag: PA3810 Name: hscA Funciton: Chaperone protein HscA Locus tag: PA3809 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system Locus tag: PA3808 Name: yfhJ Funciton: putative Fe-S cluster assembly protein
	PA3815	iscR	Iron-sulfur cluster regulator IscR
	PA3814	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	PA3813	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	PA3812	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	PA3811	hscB	Chaperone protein HscB
	PA3810	hscA	Chaperone protein HscA
	PA3809	fdx	ferredoxin, 2Fe-2S type, ISC system
	PA3808	yfhJ	putative Fe-S cluster assembly protein
Position: -81 Score: 6.4 Sequence: TTAGTTGACCATTTTTCTGGGACAA Locus tag: PA0665 Name: erpA Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
	PA0665	erpA	ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD