Regulon of IscR in Pseudomonas mendocina ymp

Properties
Regulator type:	Transcription factor
TF locus tag:	Pmen_3512
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Pseudomonadaceae
Statistics of regulated genes:
- Genes	9
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -77 Score: 7.3 Sequence: ATAGTTGACCAATTTTCTCGGGCAA Locus tag: Pmen_3930 Name: erpA Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
	Pmen_3930	erpA	ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
Position: -64 Score: 7 Sequence: ATAGTTGACTTAAATACTCGGGAAT Locus tag: Pmen_3512 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: Pmen_3511 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: Pmen_3510 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: Pmen_3509 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: Pmen_3508 Name: hscB Funciton: Chaperone protein HscB Locus tag: Pmen_3507 Name: hscA Funciton: Chaperone protein HscA Locus tag: Pmen_3506 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system Locus tag: Pmen_3505 Name: yfhJ Funciton: putative Fe-S cluster assembly protein
	Pmen_3512	iscR	Iron-sulfur cluster regulator IscR
	Pmen_3511	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	Pmen_3510	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	Pmen_3509	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	Pmen_3508	hscB	Chaperone protein HscB
	Pmen_3507	hscA	Chaperone protein HscA
	Pmen_3506	fdx	ferredoxin, 2Fe-2S type, ISC system
	Pmen_3505	yfhJ	putative Fe-S cluster assembly protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD