Regulon of IscR in Azotobacter vinelandii AvOP

Properties
Regulator type:	Transcription factor
TF locus tag:	Avin_40410
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Pseudomonadaceae
Statistics of regulated genes:
- Genes	8
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -65 Score: 6.1 Sequence: ATAGTTGATCCTGTTTGTCGGGTAT Locus tag: Avin_40410 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: Avin_40400 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: Avin_40390 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: Avin_40380 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: Avin_40370 Name: hscB Funciton: Chaperone protein HscB Locus tag: Avin_40360 Name: hscA Funciton: Chaperone protein HscA Locus tag: Avin_40350 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system Locus tag: Avin_40340 Name: yfhJ Funciton: putative Fe-S cluster assembly protein
	Avin_40410	iscR	Iron-sulfur cluster regulator IscR
	Avin_40400	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	Avin_40390	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	Avin_40380	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	Avin_40370	hscB	Chaperone protein HscB
	Avin_40360	hscA	Chaperone protein HscA
	Avin_40350	fdx	ferredoxin, 2Fe-2S type, ISC system
	Avin_40340	yfhJ	putative Fe-S cluster assembly protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD