Regulog HutC - Burkholderia
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Histidine utilization |
| Effector: | cis-Urocanic acid |
| Phylum: | Proteobacteria/beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Burkholderia
- By trascription factor - HutC
- By TF family - GntR/Others
- By effector - cis-Urocanic acid
- By pathway - Histidine utilization
| Genome | Genes | Operons |
|---|---|---|
| Burkholderia pseudomallei K96243 | 11 | 4 |
| Burkholderia mallei ATCC 23344 | 13 | 4 |
| Burkholderia sp. 383 | 16 | 6 |
| Burkholderia cepacia AMMD | 17 | 7 |
| Burkholderia vietnamiensis G4 | 14 | 3 |
| Burkholderia glumae BGR1 | 14 | 3 |
| Burkholderia xenovorans LB400 | 13 | 2 |
| Burkholderia phymatum STM815 | 13 | 2 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| COG834 (HisJ) |
|
|
*
Burkholderia sp. 383 Site: position = -340 score = 4.40935 sequence = CTCCCTGTATAGACATCACC Site: position = -132 score = 4.31925 sequence = TGAGCGGTCTAGACTGCATC Gene: Bcep18194_B0073: ABC amino acid transporter, periplasmic ligand binding protein |
*
Burkholderia cepacia AMMD Site: position = -137 score = 4.40007 sequence = CGAGCGGTCTAGACTGCATC Gene: Bamb_4897: ABC amino acid transporter, periplasmic ligand binding protein |
|
|
|
|
ABC amino acid transporter, periplasmic ligand binding protein |
| COG5285 |
|
|
Gene: Bcep18194_B0074: Phytanoyl-CoA dioxygenase |
Gene: Bamb_4896: Phytanoyl-CoA dioxygenase |
|
|
Gene: Bxe_A1483: Phytanoyl-CoA dioxygenase |
|
Phytanoyl-CoA dioxygenase |
| CRON 2. | |||||||||
| hisJ2 |
|
|
|
Gene: Bamb_5840: Histidine ABC transporter, histidine-binding periplasmic protein precursor HisJ (TC 3.A.1.3.1) |
*
Burkholderia vietnamiensis G4 Site: position = -235 score = 4.25366 sequence = AAATTTGTCTAGTCATCCTG Site: position = -75 score = 5.11355 sequence = ATGCTTGTATAGACAAATTC Gene: Bcep1808_5569: Histidine ABC transporter, histidine-binding periplasmic protein precursor HisJ (TC 3.A.1.3.1) |
*
Burkholderia glumae BGR1 Site: position = -72 score = 5.49837 sequence = ATTCTTGTCTATACAAGATC Gene: bglu_1g18060: Histidine ABC transporter, histidine-binding periplasmic protein precursor HisJ (TC 3.A.1.3.1) |
*
Burkholderia xenovorans LB400 Site: position = -240 score = 5.10281 sequence = CAACCTGTCTAGACAAAACA Site: position = -67 score = 5.32708 sequence = AGACTTGTCTATACAAATTA Gene: Bxe_B1829: Histidine ABC transporter, histidine-binding periplasmic protein precursor HisJ (TC 3.A.1.3.1) |
*
Burkholderia phymatum STM815 Site: position = -218 score = 4.26156 sequence = GAACATGTCTAGTCAGCTGC Site: position = -66 score = 5.10467 sequence = AGACTTGTCTATACATGTCC Gene: Bphy_5100: Histidine ABC transporter, histidine-binding periplasmic protein precursor HisJ (TC 3.A.1.3.1) |
Histidine ABC transporter, histidine-binding periplasmic protein precursor HisJ (TC 3.A.1.3.1) |
| hisQ2 |
|
|
|
Gene: Bamb_5839: Histidine ABC transporter, permease protein HisQ (TC 3.A.1.3.1) |
Gene: Bcep1808_5570: Histidine ABC transporter, permease protein HisQ (TC 3.A.1.3.1) |
Gene: bglu_1g18050: Histidine ABC transporter, permease protein HisQ (TC 3.A.1.3.1) |
Gene: Bxe_B1828: Histidine ABC transporter, permease protein HisQ (TC 3.A.1.3.1) |
Gene: Bphy_5101: Histidine ABC transporter, permease protein HisQ (TC 3.A.1.3.1) |
Histidine ABC transporter, permease protein HisQ (TC 3.A.1.3.1) |
| hisM2 |
|
|
|
Gene: Bamb_5838: Histidine ABC transporter, permease protein HisM (TC 3.A.1.3.1) |
Gene: Bcep1808_5571: Histidine ABC transporter, permease protein HisM (TC 3.A.1.3.1) |
Gene: bglu_1g18040: Histidine ABC transporter, permease protein HisM (TC 3.A.1.3.1) |
Gene: Bxe_B1827: Histidine ABC transporter, permease protein HisM (TC 3.A.1.3.1) |
Gene: Bphy_5102: Histidine ABC transporter, permease protein HisM (TC 3.A.1.3.1) |
Histidine ABC transporter, permease protein HisM (TC 3.A.1.3.1) |
| hisP2 |
|
|
|
Gene: Bamb_5837: Histidine ABC transporter, ATP-binding protein HisP (TC 3.A.1.3.1) |
Gene: Bcep1808_5572: Histidine ABC transporter, ATP-binding protein HisP (TC 3.A.1.3.1) |
Gene: bglu_1g18030: Histidine ABC transporter, ATP-binding protein HisP (TC 3.A.1.3.1) |
Gene: Bxe_B1826: Histidine ABC transporter, ATP-binding protein HisP (TC 3.A.1.3.1) |
Gene: Bphy_5103: Histidine ABC transporter, ATP-binding protein HisP (TC 3.A.1.3.1) |
Histidine ABC transporter, ATP-binding protein HisP (TC 3.A.1.3.1) |
| hutH2 |
|
|
|
Gene: Bamb_5836: Histidine ammonia-lyase (EC 4.3.1.3) |
Gene: Bcep1808_5573: Histidine ammonia-lyase (EC 4.3.1.3) |
Gene: bglu_1g18020: Histidine ammonia-lyase (EC 4.3.1.3) |
Gene: Bxe_B1825: Histidine ammonia-lyase (EC 4.3.1.3) |
Gene: Bphy_5104: Histidine ammonia-lyase (EC 4.3.1.3) |
Histidine ammonia-lyase (EC 4.3.1.3) |
| hutC |
|
|
|
Gene: Bamb_5835: Histidine utilization repressor, GntR family |
Gene: Bcep1808_5574: Histidine utilization repressor, GntR family |
Gene: bglu_1g18010: Histidine utilization repressor, GntR family |
Gene: Bxe_B1824: Histidine utilization repressor, GntR family |
Gene: Bphy_5105: Histidine utilization repressor, GntR family |
Histidine utilization repressor, GntR family |
| CRON 3. | |||||||||
| hisT |
*
Burkholderia pseudomallei K96243 Site: position = -79 score = 5.92124 sequence = CAAGTTGTCTATACAACTTC Gene: BPSL1280: Histidine transport protein (permease) |
*
Burkholderia mallei ATCC 23344 Site: position = -79 score = 5.92124 sequence = CAAGTTGTCTATACAACTTC Gene: BMA1774: Histidine transport protein (permease) |
*
Burkholderia sp. 383 Site: position = -77 score = 5.86278 sequence = TAAGTTGTCTATACAACTTG Gene: Bcep18194_A4320: Histidine transport protein (permease) |
*
Burkholderia cepacia AMMD Site: position = -77 score = 5.94361 sequence = CAAGTTGTATAGACAACTTG Gene: Bamb_1095: Histidine transport protein (permease) |
|
*
Burkholderia glumae BGR1 Site: position = -69 score = 5.49182 sequence = GAACCTGTCTAGACAAGCTC Gene: bglu_2g11350: Histidine transport protein (permease) |
|
|
Histidine transport protein (permease) |
| CRON 4. | |||||||||
| hisJ |
|
|
*
Burkholderia sp. 383 Site: position = -141 score = 5.28392 sequence = AAAGTTGTATGTACAACTTG Gene: Bcep18194_B2378: Histidine ABC transporter, histidine-binding periplasmic protein precursor HisJ (TC 3.A.1.3.1) |
*
Burkholderia cepacia AMMD Site: position = -113 score = 5.28392 sequence = AAAGTTGTATGTACAACTTG Gene: Bamb_5463: Histidine ABC transporter, histidine-binding periplasmic protein precursor HisJ (TC 3.A.1.3.1) |
Gene: Bcep1808_6664: Histidine ABC transporter, histidine-binding periplasmic protein precursor HisJ (TC 3.A.1.3.1) |
|
|
|
Histidine ABC transporter, histidine-binding periplasmic protein precursor HisJ (TC 3.A.1.3.1) |
| hisQ |
*
Burkholderia pseudomallei K96243 Site: position = -140 score = 5.14852 sequence = AAAGTTGTACATACAACTTC Gene: BPSS0981: Histidine ABC transporter, permease protein HisQ (TC 3.A.1.3.1) |
*
Burkholderia mallei ATCC 23344 Site: position = -140 score = 5.14852 sequence = AAAGTTGTACATACAACTTC Gene: BMAA1240: Histidine ABC transporter, permease protein HisQ (TC 3.A.1.3.1) |
Gene: Bcep18194_B2377: Histidine ABC transporter, permease protein HisQ (TC 3.A.1.3.1) |
Gene: Bamb_5464: Histidine ABC transporter, permease protein HisQ (TC 3.A.1.3.1) |
Gene: Bcep1808_6665: Histidine ABC transporter, permease protein HisQ (TC 3.A.1.3.1) |
|
|
|
Histidine ABC transporter, permease protein HisQ (TC 3.A.1.3.1) |
| hisM |
Gene: BPSS0982: Histidine ABC transporter, permease protein HisM (TC 3.A.1.3.1) |
Gene: BMAA1239: Histidine ABC transporter, permease protein HisM (TC 3.A.1.3.1) |
Gene: Bcep18194_B2376: Histidine ABC transporter, permease protein HisM (TC 3.A.1.3.1) |
Gene: Bamb_5465: Histidine ABC transporter, permease protein HisM (TC 3.A.1.3.1) |
Gene: Bcep1808_6666: Histidine ABC transporter, permease protein HisM (TC 3.A.1.3.1) |
|
|
|
Histidine ABC transporter, permease protein HisM (TC 3.A.1.3.1) |
| hisP |
Gene: BPSS0983: Histidine ABC transporter, ATP-binding protein HisP (TC 3.A.1.3.1) |
Gene: BMAA1238: Histidine ABC transporter, ATP-binding protein HisP (TC 3.A.1.3.1) |
Gene: Bcep18194_B2375: Histidine ABC transporter, ATP-binding protein HisP (TC 3.A.1.3.1) |
Gene: Bamb_5466: Histidine ABC transporter, ATP-binding protein HisP (TC 3.A.1.3.1) |
Gene: Bcep1808_6667: Histidine ABC transporter, ATP-binding protein HisP (TC 3.A.1.3.1) |
|
|
|
Histidine ABC transporter, ATP-binding protein HisP (TC 3.A.1.3.1) |
| CRON 5. | |||||||||
| COG1457 (CodB) |
*
Burkholderia pseudomallei K96243 Site: position = -71 score = 5.09292 sequence = ACAGTTGTCTATACAATTTT Gene: BPSS1752: Permease, cytosine/purines, uracil, thiamine, allantoin family protein |
*
Burkholderia mallei ATCC 23344 Site: position = -71 score = 5.09292 sequence = ACAGTTGTCTATACAATTTT Gene: BMAA0417: Permease, cytosine/purines, uracil, thiamine, allantoin family protein |
*2
Burkholderia sp. 383 Gene: Bcep18194_A4386: Permease, cytosine/purines, uracil, thiamine, allantoin family protein Site: position = -196 score = 5.88288 sequence = CAAGTTGTATATACAAGATC Gene: Bcep18194_A4383: Permease, cytosine/purines, uracil, thiamine, allantoin family protein |
*
Burkholderia cepacia AMMD Site: position = -150 score = 5.65859 sequence = CAAGTTGTATATACAAGAAT Gene: Bamb_1129: Permease, cytosine/purines, uracil, thiamine, allantoin family protein |
*
Burkholderia vietnamiensis G4 Site: position = -169 score = 5.45042 sequence = CTAGTTGTATATACAACAAT Gene: Bcep1808_1206: Permease, cytosine/purines, uracil, thiamine, allantoin family protein |
Gene: bglu_1g13020: Permease, cytosine/purines, uracil, thiamine, allantoin family protein |
|
|
Permease, cytosine/purines, uracil, thiamine, allantoin family protein |
| CRON 6. | |||||||||
| hutH |
*
Burkholderia pseudomallei K96243 Site: position = -70 score = 5.83665 sequence = CAAGTTGTCTATACAACATC Site: position = -25 score = 5.50468 sequence = AAACTTGTATAGACAGGACC Gene: BPSL2344: Histidine ammonia-lyase (EC 4.3.1.3) |
*
Burkholderia mallei ATCC 23344 Site: position = -4 score = 5.83665 sequence = CAAGTTGTCTATACAACATC Gene: BMA0645: Histidine ammonia-lyase (EC 4.3.1.3) |
*
Burkholderia sp. 383 Site: position = -26 score = 5.62002 sequence = GAACTTGTCTAGACAGGATT Site: position = -71 score = 5.49985 sequence = CGGGTTGTCTAGACAAGTTG Gene: Bcep18194_A5482: Histidine ammonia-lyase (EC 4.3.1.3) |
*
Burkholderia cepacia AMMD Site: position = -71 score = 5.45512 sequence = GGGGTTGTCTAGACAAGTTC Site: position = -26 score = 5.62002 sequence = GAACTTGTCTAGACAGGATT Gene: Bamb_2211: Histidine ammonia-lyase (EC 4.3.1.3) |
*
Burkholderia vietnamiensis G4 Site: position = -26 score = 5.62002 sequence = GAACTTGTCTAGACAGGATT Site: position = -71 score = 5.33475 sequence = CGGGTTGTCTAGACAAGTCG Gene: Bcep1808_2247: Histidine ammonia-lyase (EC 4.3.1.3) |
*
Burkholderia glumae BGR1 Site: position = -69 score = 5.40565 sequence = CGAATTGTCTATACAAGTTG Site: position = -26 score = 5.06973 sequence = TCACTTGTATAGACAGGACG Gene: bglu_1g25210: Histidine ammonia-lyase (EC 4.3.1.3) |
*3
Burkholderia xenovorans LB400 Gene: Bxe_A1482: Histidine ammonia-lyase (EC 4.3.1.3) Gene: Bxe_B0058: Histidine ammonia-lyase (EC 4.3.1.3) Site: position = -64 score = 5.69355 sequence = CAAGTTGTATATACAAGAAG Site: position = -206 score = 5.35681 sequence = TAAGGTGTATATACAAGTTA Site: position = -26 score = 5.03109 sequence = CGAATTGTATAGACAGGACG Gene: Bxe_A2947: Histidine ammonia-lyase (EC 4.3.1.3) |
*
Burkholderia phymatum STM815 Site: position = -217 score = 5.32747 sequence = GGACGTGTATATACAAGTTG Site: position = -27 score = 5.10486 sequence = GAAATTGTATAGACAGGAAC Site: position = -64 score = 5.74015 sequence = CGAGTTGTATATACAAGATG Gene: Bphy_1814: Histidine ammonia-lyase (EC 4.3.1.3) |
Histidine ammonia-lyase (EC 4.3.1.3) |
| hutC |
Gene: BPSL2343: Histidine utilization repressor, GntR family |
Gene: BMA0646: Histidine utilization repressor, GntR family |
2
Burkholderia sp. 383 Gene: Bcep18194_A5481: Histidine utilization repressor, GntR family Gene: Bcep18194_B2386: Histidine utilization repressor, GntR family |
*2
Burkholderia cepacia AMMD Site: position = -225 score = 3.72532 sequence = GCATTTGTCTATACTTTTCC Gene: Bamb_5462: Histidine utilization repressor, GntR family Gene: Bamb_2210: Histidine utilization repressor, GntR family |
2
Burkholderia vietnamiensis G4 Gene: Bcep1808_4120: Histidine utilization repressor, GntR family Gene: Bcep1808_2246: Histidine utilization repressor, GntR family |
Gene: bglu_1g25200: Histidine utilization repressor, GntR family |
Gene: Bxe_A2946: Histidine utilization repressor, GntR family |
Gene: Bphy_1813: Histidine utilization repressor, GntR family |
Histidine utilization repressor, GntR family |
| hutU |
Gene: BPSL2342: Urocanate hydratase (EC 4.2.1.49) |
Gene: BMA0647: Urocanate hydratase (EC 4.2.1.49) |
Gene: Bcep18194_A5480: Urocanate hydratase (EC 4.2.1.49) |
Gene: Bamb_2209: Urocanate hydratase (EC 4.2.1.49) |
Gene: Bcep1808_2245: Urocanate hydratase (EC 4.2.1.49) |
Gene: bglu_1g25190: Urocanate hydratase (EC 4.2.1.49) |
Gene: Bxe_A2945: Urocanate hydratase (EC 4.2.1.49) |
Gene: Bphy_1812: Urocanate hydratase (EC 4.2.1.49) |
Urocanate hydratase (EC 4.2.1.49) |
| hutD |
Gene: BPSL2341: Conserved hypothetical protein related to histidine degradation |
Gene: BMA0648: Conserved hypothetical protein related to histidine degradation |
Gene: Bcep18194_A5479: Conserved hypothetical protein related to histidine degradation |
Gene: Bamb_2208: Conserved hypothetical protein related to histidine degradation |
Gene: Bcep1808_2244: Conserved hypothetical protein related to histidine degradation |
Gene: bglu_1g25180: Conserved hypothetical protein related to histidine degradation |
Gene: Bxe_A2944: Conserved hypothetical protein related to histidine degradation |
Gene: Bphy_1811: Conserved hypothetical protein related to histidine degradation |
Conserved hypothetical protein related to histidine degradation |
| hutI |
Gene: BPSL2340: Imidazolonepropionase (EC 3.5.2.7) |
Gene: BMA0649: Imidazolonepropionase (EC 3.5.2.7) |
Gene: Bcep18194_A5478: Imidazolonepropionase (EC 3.5.2.7) |
Gene: Bamb_2207: Imidazolonepropionase (EC 3.5.2.7) |
Gene: Bcep1808_2243: Imidazolonepropionase (EC 3.5.2.7) |
Gene: bglu_1g25170: Imidazolonepropionase (EC 3.5.2.7) |
Gene: Bxe_A2943: Imidazolonepropionase (EC 3.5.2.7) |
Gene: Bphy_1810: Imidazolonepropionase (EC 3.5.2.7) |
Imidazolonepropionase (EC 3.5.2.7) |
| hutF |
Gene: BPSL2339: Formiminoglutamic iminohydrolase (EC 3.5.3.13) |
Gene: BMA0650: Formiminoglutamic iminohydrolase (EC 3.5.3.13) |
Gene: Bcep18194_A5477: Formiminoglutamic iminohydrolase (EC 3.5.3.13) |
Gene: Bamb_2206: Formiminoglutamic iminohydrolase (EC 3.5.3.13) |
Gene: Bcep1808_2242: Formiminoglutamic iminohydrolase (EC 3.5.3.13) |
Gene: bglu_1g25160: Formiminoglutamic iminohydrolase (EC 3.5.3.13) |
Gene: Bxe_A2942: Formiminoglutamic iminohydrolase (EC 3.5.3.13) |
Gene: Bphy_1809: Formiminoglutamic iminohydrolase (EC 3.5.3.13) |
Formiminoglutamic iminohydrolase (EC 3.5.3.13) |
| BMA0651 |
|
Gene: BMA0651: hypothetical protein |
|
|
|
|
|
|
hypothetical protein |
| hutG |
Gene: BPSL2338: N-formylglutamate deformylase (EC 3.5.1.68) |
Gene: BMA0652: N-formylglutamate deformylase (EC 3.5.1.68) |
Gene: Bcep18194_A5476: N-formylglutamate deformylase (EC 3.5.1.68) |
Gene: Bamb_2205: N-formylglutamate deformylase (EC 3.5.1.68) |
Gene: Bcep1808_2241: N-formylglutamate deformylase (EC 3.5.1.68) |
Gene: bglu_1g25150: N-formylglutamate deformylase (EC 3.5.1.68) |
Gene: Bxe_A2941: N-formylglutamate deformylase (EC 3.5.1.68) |
Gene: Bphy_1808: N-formylglutamate deformylase (EC 3.5.1.68) |
N-formylglutamate deformylase (EC 3.5.1.68) |
| CRON 7. | |||||||||
| COG834 (HisJ) |
|
|
*
Burkholderia sp. 383 Site: position = -207 score = 5.62002 sequence = AATCCTGTCTAGACAAGTTC Site: position = -162 score = 5.49985 sequence = CAACTTGTCTAGACAACCCG Gene: Bcep18194_A5483: ABC amino acid transporter, periplasmic ligand binding protein |
*
Burkholderia cepacia AMMD Site: position = -148 score = 5.62002 sequence = AATCCTGTCTAGACAAGTTC Site: position = -103 score = 5.45512 sequence = GAACTTGTCTAGACAACCCC Gene: Bamb_2212: ABC amino acid transporter, periplasmic ligand binding protein |
|
|
|
Gene: Bphy_4740: ABC amino acid transporter, periplasmic ligand binding protein |
ABC amino acid transporter, periplasmic ligand binding protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |