Regulon of HutC in Burkholderia mallei ATCC 23344

Properties
Regulator type:	Transcription factor
TF locus tag:	BMA0646
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Histidine utilization
Effector:	cis-Urocanic acid
Regulog:	HutC - Burkholderia
Statistics of regulated genes:
- Genes	13
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 46 sites [see more]

Member of regulog collections

By taxonomy - Burkholderia
By trascription factor - HutC
By TF family - GntR/Others
By effector - cis-Urocanic acid
By pathway - Histidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -71 Score: 5.1 Sequence: ACAGTTGTCTATACAATTTT Locus tag: BMAA0417 Name: COG1457 (CodB) Funciton: Permease, cytosine/purines, uracil, thiamine, allantoin family protein
	BMAA0417	COG1457 (CodB)	Permease, cytosine/purines, uracil, thiamine, allantoin family protein
Position: -4 Score: 5.8 Sequence: CAAGTTGTCTATACAACATC Locus tag: BMA0645 Name: hutH Funciton: Histidine ammonia-lyase (EC 4.3.1.3) Locus tag: BMA0646 Name: hutC Funciton: Histidine utilization repressor, GntR family Locus tag: BMA0647 Name: hutU Funciton: Urocanate hydratase (EC 4.2.1.49) Locus tag: BMA0648 Name: hutD Funciton: Conserved hypothetical protein related to histidine degradation Locus tag: BMA0649 Name: hutI Funciton: Imidazolonepropionase (EC 3.5.2.7) Locus tag: BMA0650 Name: hutF Funciton: Formiminoglutamic iminohydrolase (EC 3.5.3.13) Locus tag: BMA0651 Name: null Funciton: hypothetical protein Locus tag: BMA0652 Name: hutG Funciton: N-formylglutamate deformylase (EC 3.5.1.68)
	BMA0645	hutH	Histidine ammonia-lyase (EC 4.3.1.3)
	BMA0646	hutC	Histidine utilization repressor, GntR family
	BMA0647	hutU	Urocanate hydratase (EC 4.2.1.49)
	BMA0648	hutD	Conserved hypothetical protein related to histidine degradation
	BMA0649	hutI	Imidazolonepropionase (EC 3.5.2.7)
	BMA0650	hutF	Formiminoglutamic iminohydrolase (EC 3.5.3.13)
	BMA0651		hypothetical protein
	BMA0652	hutG	N-formylglutamate deformylase (EC 3.5.1.68)
Position: -140 Score: 5.1 Sequence: AAAGTTGTACATACAACTTC Locus tag: BMAA1240 Name: hisQ Funciton: Histidine ABC transporter, permease protein HisQ (TC 3.A.1.3.1) Locus tag: BMAA1239 Name: hisM Funciton: Histidine ABC transporter, permease protein HisM (TC 3.A.1.3.1) Locus tag: BMAA1238 Name: hisP Funciton: Histidine ABC transporter, ATP-binding protein HisP (TC 3.A.1.3.1)
	BMAA1240	hisQ	Histidine ABC transporter, permease protein HisQ (TC 3.A.1.3.1)
	BMAA1239	hisM	Histidine ABC transporter, permease protein HisM (TC 3.A.1.3.1)
	BMAA1238	hisP	Histidine ABC transporter, ATP-binding protein HisP (TC 3.A.1.3.1)
Position: -79 Score: 5.9 Sequence: CAAGTTGTCTATACAACTTC Locus tag: BMA1774 Name: hisT Funciton: Histidine transport protein (permease)
	BMA1774	hisT	Histidine transport protein (permease)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD