Regulon of HutC in Burkholderia phymatum STM815

Properties
Regulator type:	Transcription factor
TF locus tag:	Bphy_5105, Bphy_5106, Bphy_1813
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Histidine utilization
Effector:	cis-Urocanic acid
Regulog:	HutC - Burkholderia
Statistics of regulated genes:
- Genes	13
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 46 sites [see more]

Member of regulog collections

By taxonomy - Burkholderia
By trascription factor - HutC
By TF family - GntR/Others
By effector - cis-Urocanic acid
By pathway - Histidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -217 Score: 5.3 Sequence: GGACGTGTATATACAAGTTG Position: -64 Score: 5.7 Sequence: CGAGTTGTATATACAAGATG Position: -27 Score: 5.1 Sequence: GAAATTGTATAGACAGGAAC Locus tag: Bphy_1814 Name: hutH Funciton: Histidine ammonia-lyase (EC 4.3.1.3) Locus tag: Bphy_1813 Name: hutC Funciton: Histidine utilization repressor, GntR family Locus tag: Bphy_1812 Name: hutU Funciton: Urocanate hydratase (EC 4.2.1.49) Locus tag: Bphy_1811 Name: hutD Funciton: Conserved hypothetical protein related to histidine degradation Locus tag: Bphy_1810 Name: hutI Funciton: Imidazolonepropionase (EC 3.5.2.7) Locus tag: Bphy_1809 Name: hutF Funciton: Formiminoglutamic iminohydrolase (EC 3.5.3.13) Locus tag: Bphy_1808 Name: hutG Funciton: N-formylglutamate deformylase (EC 3.5.1.68)
	Bphy_1814	hutH	Histidine ammonia-lyase (EC 4.3.1.3)
	Bphy_1813	hutC	Histidine utilization repressor, GntR family
	Bphy_1812	hutU	Urocanate hydratase (EC 4.2.1.49)
	Bphy_1811	hutD	Conserved hypothetical protein related to histidine degradation
	Bphy_1810	hutI	Imidazolonepropionase (EC 3.5.2.7)
	Bphy_1809	hutF	Formiminoglutamic iminohydrolase (EC 3.5.3.13)
	Bphy_1808	hutG	N-formylglutamate deformylase (EC 3.5.1.68)
Position: -218 Score: 4.3 Sequence: GAACATGTCTAGTCAGCTGC Position: -66 Score: 5.1 Sequence: AGACTTGTCTATACATGTCC Locus tag: Bphy_5100 Name: hisJ2 Funciton: Histidine ABC transporter, histidine-binding periplasmic protein precursor HisJ (TC 3.A.1.3.1) Locus tag: Bphy_5101 Name: hisQ2 Funciton: Histidine ABC transporter, permease protein HisQ (TC 3.A.1.3.1) Locus tag: Bphy_5102 Name: hisM2 Funciton: Histidine ABC transporter, permease protein HisM (TC 3.A.1.3.1) Locus tag: Bphy_5103 Name: hisP2 Funciton: Histidine ABC transporter, ATP-binding protein HisP (TC 3.A.1.3.1) Locus tag: Bphy_5104 Name: hutH2 Funciton: Histidine ammonia-lyase (EC 4.3.1.3) Locus tag: Bphy_5105 Name: hutC Funciton: Histidine utilization repressor, GntR family
	Bphy_5100	hisJ2	Histidine ABC transporter, histidine-binding periplasmic protein precursor HisJ (TC 3.A.1.3.1)
	Bphy_5101	hisQ2	Histidine ABC transporter, permease protein HisQ (TC 3.A.1.3.1)
	Bphy_5102	hisM2	Histidine ABC transporter, permease protein HisM (TC 3.A.1.3.1)
	Bphy_5103	hisP2	Histidine ABC transporter, ATP-binding protein HisP (TC 3.A.1.3.1)
	Bphy_5104	hutH2	Histidine ammonia-lyase (EC 4.3.1.3)
	Bphy_5105	hutC	Histidine utilization repressor, GntR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD