Regulon of HutC in Burkholderia xenovorans LB400

Properties
Regulator type:	Transcription factor
TF locus tag:	Bxe_B1824, Bxe_B1823, Bxe_A2946
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Histidine utilization
Effector:	cis-Urocanic acid
Regulog:	HutC - Burkholderia
Statistics of regulated genes:
- Genes	13
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 46 sites [see more]

Member of regulog collections

By taxonomy - Burkholderia
By trascription factor - HutC
By TF family - GntR/Others
By effector - cis-Urocanic acid
By pathway - Histidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -240 Score: 5.1 Sequence: CAACCTGTCTAGACAAAACA Position: -67 Score: 5.3 Sequence: AGACTTGTCTATACAAATTA Locus tag: Bxe_B1829 Name: hisJ2 Funciton: Histidine ABC transporter, histidine-binding periplasmic protein precursor HisJ (TC 3.A.1.3.1) Locus tag: Bxe_B1828 Name: hisQ2 Funciton: Histidine ABC transporter, permease protein HisQ (TC 3.A.1.3.1) Locus tag: Bxe_B1827 Name: hisM2 Funciton: Histidine ABC transporter, permease protein HisM (TC 3.A.1.3.1) Locus tag: Bxe_B1826 Name: hisP2 Funciton: Histidine ABC transporter, ATP-binding protein HisP (TC 3.A.1.3.1) Locus tag: Bxe_B1825 Name: hutH2 Funciton: Histidine ammonia-lyase (EC 4.3.1.3) Locus tag: Bxe_B1824 Name: hutC Funciton: Histidine utilization repressor, GntR family
	Bxe_B1829	hisJ2	Histidine ABC transporter, histidine-binding periplasmic protein precursor HisJ (TC 3.A.1.3.1)
	Bxe_B1828	hisQ2	Histidine ABC transporter, permease protein HisQ (TC 3.A.1.3.1)
	Bxe_B1827	hisM2	Histidine ABC transporter, permease protein HisM (TC 3.A.1.3.1)
	Bxe_B1826	hisP2	Histidine ABC transporter, ATP-binding protein HisP (TC 3.A.1.3.1)
	Bxe_B1825	hutH2	Histidine ammonia-lyase (EC 4.3.1.3)
	Bxe_B1824	hutC	Histidine utilization repressor, GntR family
Position: -206 Score: 5.4 Sequence: TAAGGTGTATATACAAGTTA Position: -64 Score: 5.7 Sequence: CAAGTTGTATATACAAGAAG Position: -26 Score: 5 Sequence: CGAATTGTATAGACAGGACG Locus tag: Bxe_A2947 Name: hutH Funciton: Histidine ammonia-lyase (EC 4.3.1.3) Locus tag: Bxe_A2946 Name: hutC Funciton: Histidine utilization repressor, GntR family Locus tag: Bxe_A2945 Name: hutU Funciton: Urocanate hydratase (EC 4.2.1.49) Locus tag: Bxe_A2944 Name: hutD Funciton: Conserved hypothetical protein related to histidine degradation Locus tag: Bxe_A2943 Name: hutI Funciton: Imidazolonepropionase (EC 3.5.2.7) Locus tag: Bxe_A2942 Name: hutF Funciton: Formiminoglutamic iminohydrolase (EC 3.5.3.13) Locus tag: Bxe_A2941 Name: hutG Funciton: N-formylglutamate deformylase (EC 3.5.1.68)
	Bxe_A2947	hutH	Histidine ammonia-lyase (EC 4.3.1.3)
	Bxe_A2946	hutC	Histidine utilization repressor, GntR family
	Bxe_A2945	hutU	Urocanate hydratase (EC 4.2.1.49)
	Bxe_A2944	hutD	Conserved hypothetical protein related to histidine degradation
	Bxe_A2943	hutI	Imidazolonepropionase (EC 3.5.2.7)
	Bxe_A2942	hutF	Formiminoglutamic iminohydrolase (EC 3.5.3.13)
	Bxe_A2941	hutG	N-formylglutamate deformylase (EC 3.5.1.68)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD