Regulon of HutC in Burkholderia glumae BGR1

Properties
Regulator type:	Transcription factor
TF locus tag:	bglu_1g18010, bglu_1g25200
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Histidine utilization
Effector:	cis-Urocanic acid
Regulog:	HutC - Burkholderia
Statistics of regulated genes:
- Genes	14
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 46 sites [see more]

Member of regulog collections

By taxonomy - Burkholderia
By trascription factor - HutC
By TF family - GntR/Others
By effector - cis-Urocanic acid
By pathway - Histidine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -72 Score: 5.5 Sequence: ATTCTTGTCTATACAAGATC Locus tag: bglu_1g18060 Name: hisJ2 Funciton: Histidine ABC transporter, histidine-binding periplasmic protein precursor HisJ (TC 3.A.1.3.1) Locus tag: bglu_1g18050 Name: hisQ2 Funciton: Histidine ABC transporter, permease protein HisQ (TC 3.A.1.3.1) Locus tag: bglu_1g18040 Name: hisM2 Funciton: Histidine ABC transporter, permease protein HisM (TC 3.A.1.3.1) Locus tag: bglu_1g18030 Name: hisP2 Funciton: Histidine ABC transporter, ATP-binding protein HisP (TC 3.A.1.3.1) Locus tag: bglu_1g18020 Name: hutH2 Funciton: Histidine ammonia-lyase (EC 4.3.1.3) Locus tag: bglu_1g18010 Name: hutC Funciton: Histidine utilization repressor, GntR family
	bglu_1g18060	hisJ2	Histidine ABC transporter, histidine-binding periplasmic protein precursor HisJ (TC 3.A.1.3.1)
	bglu_1g18050	hisQ2	Histidine ABC transporter, permease protein HisQ (TC 3.A.1.3.1)
	bglu_1g18040	hisM2	Histidine ABC transporter, permease protein HisM (TC 3.A.1.3.1)
	bglu_1g18030	hisP2	Histidine ABC transporter, ATP-binding protein HisP (TC 3.A.1.3.1)
	bglu_1g18020	hutH2	Histidine ammonia-lyase (EC 4.3.1.3)
	bglu_1g18010	hutC	Histidine utilization repressor, GntR family
Position: -69 Score: 5.5 Sequence: GAACCTGTCTAGACAAGCTC Locus tag: bglu_2g11350 Name: hisT Funciton: Histidine transport protein (permease)
	bglu_2g11350	hisT	Histidine transport protein (permease)
Position: -69 Score: 5.4 Sequence: CGAATTGTCTATACAAGTTG Position: -26 Score: 5.1 Sequence: TCACTTGTATAGACAGGACG Locus tag: bglu_1g25210 Name: hutH Funciton: Histidine ammonia-lyase (EC 4.3.1.3) Locus tag: bglu_1g25200 Name: hutC Funciton: Histidine utilization repressor, GntR family Locus tag: bglu_1g25190 Name: hutU Funciton: Urocanate hydratase (EC 4.2.1.49) Locus tag: bglu_1g25180 Name: hutD Funciton: Conserved hypothetical protein related to histidine degradation Locus tag: bglu_1g25170 Name: hutI Funciton: Imidazolonepropionase (EC 3.5.2.7) Locus tag: bglu_1g25160 Name: hutF Funciton: Formiminoglutamic iminohydrolase (EC 3.5.3.13) Locus tag: bglu_1g25150 Name: hutG Funciton: N-formylglutamate deformylase (EC 3.5.1.68)
	bglu_1g25210	hutH	Histidine ammonia-lyase (EC 4.3.1.3)
	bglu_1g25200	hutC	Histidine utilization repressor, GntR family
	bglu_1g25190	hutU	Urocanate hydratase (EC 4.2.1.49)
	bglu_1g25180	hutD	Conserved hypothetical protein related to histidine degradation
	bglu_1g25170	hutI	Imidazolonepropionase (EC 3.5.2.7)
	bglu_1g25160	hutF	Formiminoglutamic iminohydrolase (EC 3.5.3.13)
	bglu_1g25150	hutG	N-formylglutamate deformylase (EC 3.5.1.68)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD