Regulog Zur - Sphingomonadales
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Proteobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Sphingomonadales
- By trascription factor - Zur
- By TF family - FUR
- By effector - Zinc ion, (Zn2+)
- By pathway - Zinc homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Erythrobacter litoralis HTCC2594 | 2 | 2 |
| Erythrobacter sp. NAP1 | 2 | 2 |
| Novosphingobium aromaticivorans DSM 12444 | 2 | 2 |
| Sphingopyxis alaskensis RB2256 | 3 | 3 |
| Sphingobium japonicum UT26S | 4 | 4 |
| Sphingomonas wittichii RW1 | 2 | 2 |
| Zymomonas mobilis subsp. mobilis ZM4 | 7 | 6 |
| Genes | Function | |||||||
|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||
| omr1 |
|
|
|
|
|
|
*
Zymomonas mobilis subsp. mobilis ZM4 Site: position = -35 score = 5.27228 sequence = GATATGATATATTATATCATCTA Gene: ZMO0795: Predicted zinc-regulated TonB-dependent outer membrane transporter |
Predicted zinc-regulated TonB-dependent outer membrane transporter |
| CRON 2. | ||||||||
| omr |
*
Erythrobacter litoralis HTCC2594 Site: position = -89 score = 5.10701 sequence = ATAATGTTATTCTGTATCATCCG Gene: ELI_11505: Predicted zinc-regulated TonB-dependent outer membrane transporter |
*
Erythrobacter sp. NAP1 Site: position = -56 score = 5.63837 sequence = ACGTTGTTACATTGTAACGTTAT Gene: NAP1_14638: Predicted zinc-regulated TonB-dependent outer membrane transporter |
*
Novosphingobium aromaticivorans DSM 12444 Site: position = -109 score = 5.6322 sequence = GATATGTTATCTTGTAACATGAC Gene: Saro_0754: Predicted zinc-regulated TonB-dependent outer membrane transporter |
*
Sphingopyxis alaskensis RB2256 Site: position = -67 score = 5.29188 sequence = TCATTGTGACAGTATATCATTAC Gene: Sala_1894: Predicted zinc-regulated TonB-dependent outer membrane transporter |
*2
Sphingobium japonicum UT26S Site: position = -68 score = 5.34428 sequence = GTATTGATATGCTATATCATTTC Gene: SJA_C1-31170: Predicted zinc-regulated TonB-dependent outer membrane transporter Site: position = -111 score = 5.76774 sequence = GAGATGTTATCTTGTATCATCGT Gene: SJA_C1-18900: Predicted zinc-regulated TonB-dependent outer membrane transporter |
Gene: Swit_0540: Predicted zinc-regulated TonB-dependent outer membrane transporter |
|
Predicted zinc-regulated TonB-dependent outer membrane transporter |
| CRON 3. | ||||||||
| tonB1 |
|
|
|
*
Sphingopyxis alaskensis RB2256 Site: position = -91 score = 5.59794 sequence = ATGACGTGATGTTATAACATCAT Gene: Sala_2946: Ferric siderophore transport system, periplasmic binding protein TonB |
*
Sphingobium japonicum UT26S Site: position = -88 score = 5.19871 sequence = TAAATTTAATGTTGCAACATATC Gene: SJA_C1-02890: Ferric siderophore transport system, periplasmic binding protein TonB |
*
Sphingomonas wittichii RW1 Site: position = -70 score = 5.11565 sequence = CCATCGTAATGATGTATCATTGC Gene: Swit_2441: Ferric siderophore transport system, periplasmic binding protein TonB |
|
Ferric siderophore transport system, periplasmic binding protein TonB |
| CRON 4. | ||||||||
| tonB2 |
*
Erythrobacter litoralis HTCC2594 Site: position = -85 score = 6.02872 sequence = TAGATGTTATGTTGTCACATTAC Gene: ELI_02180: Ferric siderophore transport system, periplasmic binding protein TonB |
*
Erythrobacter sp. NAP1 Site: position = -97 score = 5.80879 sequence = CAAATGTTATGTTGCAACATTCT Gene: NAP1_01425: Ferric siderophore transport system, periplasmic binding protein TonB |
|
|
|
|
|
Ferric siderophore transport system, periplasmic binding protein TonB |
| CRON 5. | ||||||||
| omr2 |
|
|
|
|
|
|
*
Zymomonas mobilis subsp. mobilis ZM4 Site: position = -46 score = 5.98616 sequence = GAAATGTTATGTTATCACATAAC Gene: ZMO0902: Predicted zinc-regulated TonB-dependent outer membrane transporter |
Predicted zinc-regulated TonB-dependent outer membrane transporter |
| CRON 6. | ||||||||
| feoA |
Gene: ELI_00185: Ferrous iron transport protein A |
|
Gene: Saro_2850: Ferrous iron transport protein A |
Gene: Sala_2986: Ferrous iron transport protein A |
Gene: SJA_C1-02970: Ferrous iron transport protein A |
Gene: Swit_2450: Ferrous iron transport protein A |
*
Zymomonas mobilis subsp. mobilis ZM4 Site: position = -186 score = 5.95884 sequence = ACATTGTTATGTTATAATATTAC Gene: ZMO1540: Ferrous iron transport protein A |
Ferrous iron transport protein A |
| feoB |
Gene: ELI_00190: Ferrous iron transport protein B |
|
Gene: Saro_2849: Ferrous iron transport protein B |
Gene: Sala_2987: Ferrous iron transport protein B |
Gene: SJA_C1-02980: Ferrous iron transport protein B |
Gene: Swit_2451: Ferrous iron transport protein B |
Gene: ZMO1541: Ferrous iron transport protein B |
Ferrous iron transport protein B |
| CRON 7. | ||||||||
| czdD |
|
|
|
|
|
|
*
Zymomonas mobilis subsp. mobilis ZM4 Site: position = -53 score = 5.27496 sequence = GTAATGTGATATTATAACTTTTG Gene: ZMO0866: Cobalt-zinc-cadmium resistance protein CzcD |
Cobalt-zinc-cadmium resistance protein CzcD |
| CRON 8. | ||||||||
| omr3 |
Gene: ELI_00385: Predicted zinc-regulated TonB-dependent outer membrane transporter |
Gene: NAP1_15908: Predicted zinc-regulated TonB-dependent outer membrane transporter |
Gene: Saro_3280: Predicted zinc-regulated TonB-dependent outer membrane transporter |
Gene: Sala_2091: Predicted zinc-regulated TonB-dependent outer membrane transporter |
|
|
*
Zymomonas mobilis subsp. mobilis ZM4 Site: position = -154 score = 5.21969 sequence = TTAATGTTTTATTATAAAATAAT Gene: ZMO1822: Predicted zinc-regulated TonB-dependent outer membrane transporter |
Predicted zinc-regulated TonB-dependent outer membrane transporter |
| CRON 9. | ||||||||
| PF03203 |
Gene: ELI_12845: MerC-like membrane protein |
Gene: NAP1_13188: MerC-like membrane protein |
*
Novosphingobium aromaticivorans DSM 12444 Site: position = -35 score = 5.45963 sequence = ACTATGTAACATTATAACATAAA Gene: Saro_3289: MerC-like membrane protein |
*
Sphingopyxis alaskensis RB2256 Site: position = -71 score = 5.56521 sequence = ACAATGTGATGTTGTAACCTTGG Gene: Sala_0375: MerC-like membrane protein |
*
Sphingobium japonicum UT26S Site: position = -49 score = 5.70742 sequence = GCGATGATATGTTGTAACTTTCC Gene: SJA_C1-07260: MerC-like membrane protein |
*
Sphingomonas wittichii RW1 Site: position = -55 score = 5.39774 sequence = GCAATGATATATTGTATCTTCGA Gene: Swit_1463: MerC-like membrane protein |
*
Zymomonas mobilis subsp. mobilis ZM4 Site: position = -110 score = 5.03007 sequence = CCGCCGTTACGTTGTAACATATA Gene: ZMO0885: MerC-like membrane protein |
MerC-like membrane protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |