Regulon of Zur in Sphingobium japonicum UT26S

Properties
Regulator type:	Transcription factor
TF locus tag:	SJA_C1-18880, SJA_C1-22850, SJA_C1-19040
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Sphingomonadales
Statistics of regulated genes:
- Genes	4
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Sphingomonadales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -68 Score: 5.3 Sequence: GTATTGATATGCTATATCATTTC Locus tag: SJA_C1-31170 Name: omr Funciton: Predicted zinc-regulated TonB-dependent outer membrane transporter
	SJA_C1-31170	omr	Predicted zinc-regulated TonB-dependent outer membrane transporter
Position: -88 Score: 5.2 Sequence: TAAATTTAATGTTGCAACATATC Locus tag: SJA_C1-02890 Name: tonB1 Funciton: Ferric siderophore transport system, periplasmic binding protein TonB
	SJA_C1-02890	tonB1	Ferric siderophore transport system, periplasmic binding protein TonB
Position: -111 Score: 5.8 Sequence: GAGATGTTATCTTGTATCATCGT Locus tag: SJA_C1-18900 Name: omr Funciton: Predicted zinc-regulated TonB-dependent outer membrane transporter
	SJA_C1-18900	omr	Predicted zinc-regulated TonB-dependent outer membrane transporter
Position: -49 Score: 5.7 Sequence: GCGATGATATGTTGTAACTTTCC Locus tag: SJA_C1-07260 Name: PF03203 Funciton: MerC-like membrane protein
	SJA_C1-07260	PF03203	MerC-like membrane protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD