Regulon of Zur in Novosphingobium aromaticivorans DSM 12444

Properties
Regulator type:	Transcription factor
TF locus tag:	Saro_0159
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Sphingomonadales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Sphingomonadales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -35 Score: 5.5 Sequence: ACTATGTAACATTATAACATAAA Locus tag: Saro_3289 Name: PF03203 Funciton: MerC-like membrane protein
	Saro_3289	PF03203	MerC-like membrane protein
Position: -109 Score: 5.6 Sequence: GATATGTTATCTTGTAACATGAC Locus tag: Saro_0754 Name: omr Funciton: Predicted zinc-regulated TonB-dependent outer membrane transporter
	Saro_0754	omr	Predicted zinc-regulated TonB-dependent outer membrane transporter

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD