Regulon of Zur in Sphingopyxis alaskensis RB2256

Properties
Regulator type:	Transcription factor
TF locus tag:	Sala_0376
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Sphingomonadales
Statistics of regulated genes:
- Genes	3
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Sphingomonadales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -67 Score: 5.3 Sequence: TCATTGTGACAGTATATCATTAC Locus tag: Sala_1894 Name: omr Funciton: Predicted zinc-regulated TonB-dependent outer membrane transporter
	Sala_1894	omr	Predicted zinc-regulated TonB-dependent outer membrane transporter
Position: -71 Score: 5.6 Sequence: ACAATGTGATGTTGTAACCTTGG Locus tag: Sala_0375 Name: PF03203 Funciton: MerC-like membrane protein
	Sala_0375	PF03203	MerC-like membrane protein
Position: -91 Score: 5.6 Sequence: ATGACGTGATGTTATAACATCAT Locus tag: Sala_2946 Name: tonB1 Funciton: Ferric siderophore transport system, periplasmic binding protein TonB
	Sala_2946	tonB1	Ferric siderophore transport system, periplasmic binding protein TonB

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD