Regulon of Zur in Erythrobacter litoralis HTCC2594

Properties
Regulator type:	Transcription factor
TF locus tag:	ELI_12525
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Sphingomonadales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Sphingomonadales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -89 Score: 5.1 Sequence: ATAATGTTATTCTGTATCATCCG Locus tag: ELI_11505 Name: omr Funciton: Predicted zinc-regulated TonB-dependent outer membrane transporter
	ELI_11505	omr	Predicted zinc-regulated TonB-dependent outer membrane transporter
Position: -85 Score: 6 Sequence: TAGATGTTATGTTGTCACATTAC Locus tag: ELI_02180 Name: tonB2 Funciton: Ferric siderophore transport system, periplasmic binding protein TonB
	ELI_02180	tonB2	Ferric siderophore transport system, periplasmic binding protein TonB

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD