Regulon of Zur in Sphingomonas wittichii RW1

Properties
Regulator type:	Transcription factor
TF locus tag:	Swit_1462
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Sphingomonadales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Sphingomonadales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -70 Score: 5.1 Sequence: CCATCGTAATGATGTATCATTGC Locus tag: Swit_2441 Name: tonB1 Funciton: Ferric siderophore transport system, periplasmic binding protein TonB
	Swit_2441	tonB1	Ferric siderophore transport system, periplasmic binding protein TonB
Position: -55 Score: 5.4 Sequence: GCAATGATATATTGTATCTTCGA Locus tag: Swit_1463 Name: PF03203 Funciton: MerC-like membrane protein
	Swit_1463	PF03203	MerC-like membrane protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD