Regulon of Zur in Zymomonas mobilis subsp. mobilis ZM4

Properties
Regulator type:	Transcription factor
TF locus tag:	ZMO1235
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Sphingomonadales
Statistics of regulated genes:
- Genes	7
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Sphingomonadales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -186 Score: 6 Sequence: ACATTGTTATGTTATAATATTAC Locus tag: ZMO1540 Name: feoA Funciton: Ferrous iron transport protein A Locus tag: ZMO1541 Name: feoB Funciton: Ferrous iron transport protein B
	ZMO1540	feoA	Ferrous iron transport protein A
	ZMO1541	feoB	Ferrous iron transport protein B
Position: -154 Score: 5.2 Sequence: TTAATGTTTTATTATAAAATAAT Locus tag: ZMO1822 Name: omr3 Funciton: Predicted zinc-regulated TonB-dependent outer membrane transporter
	ZMO1822	omr3	Predicted zinc-regulated TonB-dependent outer membrane transporter
Position: -53 Score: 5.3 Sequence: GTAATGTGATATTATAACTTTTG Locus tag: ZMO0866 Name: czdD Funciton: Cobalt-zinc-cadmium resistance protein CzcD
	ZMO0866	czdD	Cobalt-zinc-cadmium resistance protein CzcD
Position: -35 Score: 5.3 Sequence: GATATGATATATTATATCATCTA Locus tag: ZMO0795 Name: omr1 Funciton: Predicted zinc-regulated TonB-dependent outer membrane transporter
	ZMO0795	omr1	Predicted zinc-regulated TonB-dependent outer membrane transporter
Position: -110 Score: 5 Sequence: CCGCCGTTACGTTGTAACATATA Locus tag: ZMO0885 Name: PF03203 Funciton: MerC-like membrane protein
	ZMO0885	PF03203	MerC-like membrane protein
Position: -46 Score: 6 Sequence: GAAATGTTATGTTATCACATAAC Locus tag: ZMO0902 Name: omr2 Funciton: Predicted zinc-regulated TonB-dependent outer membrane transporter
	ZMO0902	omr2	Predicted zinc-regulated TonB-dependent outer membrane transporter

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD