Regulog LexA - Enterobacteriales
| Regulator type: | Transcription factor |
| Regulator family: | LexA |
| Regulation mode: | repressor |
| Biological process: | SOS response |
| Effector: | DNA damage |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Enterobacteriales
- By trascription factor - LexA
- By TF family - LexA
- By effector - DNA damage
- By pathway - SOS response
| Genome | Genes | Operons |
|---|---|---|
| Escherichia coli str. K-12 substr. MG1655 | 30 | 26 |
| Salmonella typhimurium LT2 | 32 | 27 |
| Citrobacter koseri ATCC BAA-895 | 22 | 21 |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | 27 | 22 |
| Enterobacter sp. 638 | 27 | 23 |
| Erwinia amylovora ATCC 49946 | 22 | 19 |
| Yersinia pestis KIM | 17 | 15 |
| Serratia proteamaculans 568 | 18 | 16 |
| Erwinia carotovora subsp. atroseptica SCRI1043 | 17 | 15 |
| Edwardsiella tarda EIB202 | 18 | 15 |
| Proteus mirabilis HI4320 | 20 | 16 |
| Photorhabdus luminescens subsp. laumondii TTO1 | 16 | 15 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| umuD |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -39 score = 6.0539 sequence = TACTGTATATAAAAACAGTA Gene: b1183: DNA polymerase V, subunit UmuD |
*
Salmonella typhimurium LT2 Site: position = -35 score = 6.0539 sequence = TACTGTATATAAAAACAGTA Gene: STM1998: DNA polymerase V, subunit UmuD |
*
Citrobacter koseri ATCC BAA-895 Site: position = -38 score = 5.89186 sequence = TACTGTATATATAATCAGTA Gene: CKO_01842: DNA polymerase V, subunit UmuD |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -40 score = 5.8081 sequence = TACTGTATATAAAAACAGTG Gene: KPN_01438: DNA polymerase V, subunit UmuD |
*
Enterobacter sp. 638 Site: position = -34 score = 5.93694 sequence = TACTGTATGTAAAAACAGTA Gene: Ent638_2213: DNA polymerase V, subunit UmuD |
|
|
|
|
|
*
Proteus mirabilis HI4320 Site: position = -47 score = 6.14366 sequence = TACTGTATAAATAAACAGTA Gene: PMI2484: DNA polymerase V, subunit UmuD |
|
DNA polymerase V, subunit UmuD |
| umuC |
Gene: b1184: DNA polymerase V, subunit UmuC |
Gene: STM1997: DNA polymerase V, subunit UmuC |
Gene: CKO_01841: DNA polymerase V, subunit UmuC |
Gene: KPN_01439: DNA polymerase V, subunit UmuC |
Gene: Ent638_2212: DNA polymerase V, subunit UmuC |
|
|
|
|
|
Gene: PMI2485: DNA polymerase V, subunit UmuC |
|
DNA polymerase V, subunit UmuC |
| CRON 2. | |||||||||||||
| sulA |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -42 score = 5.58938 sequence = TACTGTACATCCATACAGTA Gene: b0958: Cell division inhibitor sulA |
*
Salmonella typhimurium LT2 Site: position = -41 score = 6.17771 sequence = TACTGTATGAATATACAGTA Gene: STM1071: Cell division inhibitor sulA |
*
Citrobacter koseri ATCC BAA-895 Site: position = -41 score = 6.02504 sequence = TACTGTATATCCATACAGTA Gene: CKO_02110: Cell division inhibitor sulA |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -39 score = 5.97269 sequence = TACTGTATATGCATACAGTA Gene: KPN_00987: Cell division inhibitor sulA |
*
Enterobacter sp. 638 Site: position = -34 score = 6.17771 sequence = TACTGTATATTCATACAGTA Gene: Ent638_1470: Cell division inhibitor sulA |
*
Erwinia amylovora ATCC 49946 Site: position = -40 score = 5.6787 sequence = TACTGTATATCCATACAGTC Gene: EAM_1378: Cell division inhibitor sulA |
*
Yersinia pestis KIM Site: position = -39 score = 6.05196 sequence = TACTGTATATACATACAGCA Gene: y2734: Cell division inhibitor sulA |
*
Serratia proteamaculans 568 Site: position = -41 score = 5.93191 sequence = TACTGTATAAACATACAGTG Gene: Spro_1755: Cell division inhibitor sulA |
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -41 score = 6.06075 sequence = TACTGTATGTTCATACAGTA Gene: ECA1752: Cell division inhibitor sulA |
*
Edwardsiella tarda EIB202 Site: position = -115 score = 5.86477 sequence = TACTGTATAAGCATACAGTA Gene: ETAE_1269: Cell division inhibitor sulA |
*
Proteus mirabilis HI4320 Site: position = -39 score = 6.28564 sequence = TACTGTATATACATACAGTA Gene: PMI0786: Cell division inhibitor sulA |
*
Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -40 score = 5.9691 sequence = TACTGTATATTAATACAGTT Gene: plu1776: Cell division inhibitor sulA |
Cell division inhibitor sulA |
| CRON 3. | |||||||||||||
| uvrD |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -76 score = 4.88221 sequence = ATCTGTATATATACCCAGCT Gene: b3813: ATP-dependent DNA helicase II |
*
Salmonella typhimurium LT2 Site: position = -125 score = 4.76243 sequence = TTCTGTATAAATTCCCAGTT Gene: STM3951: ATP-dependent DNA helicase II |
*
Citrobacter koseri ATCC BAA-895 Site: position = -76 score = 5.0196 sequence = TATTGTATATATACCCAGCT Gene: CKO_00155: ATP-dependent DNA helicase II |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -53 score = 4.6323 sequence = CTCTGTATATATTAACAGGG Gene: KPN_04312: ATP-dependent DNA helicase II |
*
Enterobacter sp. 638 Site: position = -68 score = 5.1075 sequence = TATTGTATAAATCAACAGTA Gene: Ent638_3979: ATP-dependent DNA helicase II |
*
Erwinia amylovora ATCC 49946 Site: position = -55 score = 4.95805 sequence = ACCTGGTTATTTAACCAGTG Gene: EAM_0187: ATP-dependent DNA helicase II |
*
Yersinia pestis KIM Site: position = -82 score = 4.73719 sequence = CCCTGTGTAAATCTACAGTG Gene: y0389: ATP-dependent DNA helicase II |
*
Serratia proteamaculans 568 Site: position = -56 score = 4.39871 sequence = CTCTGTATAAATTCCCAGTG Gene: Spro_0186: ATP-dependent DNA helicase II |
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -71 score = 4.51219 sequence = ATCTGTATAAATCACCAGTG Gene: ECA4179: ATP-dependent DNA helicase II |
*
Edwardsiella tarda EIB202 Site: position = -65 score = 5.03689 sequence = TTCTGTATAAATCTCCAGTA Gene: ETAE_0126: ATP-dependent DNA helicase II |
*
Proteus mirabilis HI4320 Site: position = -47 score = 5.05575 sequence = TTCTGTATATATCCACAGTA Gene: PMI3340: ATP-dependent DNA helicase II |
*
Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -55 score = 5.0445 sequence = TTCTGTATAAAAACACAGCA Gene: plu4636: ATP-dependent DNA helicase II |
ATP-dependent DNA helicase II |
| CRON 4. | |||||||||||||
| recA |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -79 score = 5.74781 sequence = TACTGTATGAGCATACAGTA Gene: b2699: Recombinase A |
*
Salmonella typhimurium LT2 Site: position = -84 score = 5.74781 sequence = TACTGTATGAGCATACAGTA Gene: STM2829: Recombinase A |
*
Citrobacter koseri ATCC BAA-895 Site: position = -96 score = 5.48145 sequence = TACTGTATGACTGTACAGTA Gene: CKO_04050: Recombinase A |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -90 score = 5.80015 sequence = TACTGTATGACCATACAGTA Gene: KPN_03031: Recombinase A |
*
Enterobacter sp. 638 Site: position = -92 score = 5.91711 sequence = TACTGTATGACTATACAGTA Gene: Ent638_3174: Recombinase A |
*
Erwinia amylovora ATCC 49946 Site: position = -88 score = 6.06979 sequence = TACTGTATGATTATACAGTA Gene: EAM_2640: Recombinase A |
*2
Yersinia pestis KIM Gene: Y1113: Recombinase A Site: position = -102 score = 5.63413 sequence = TACTGTATGATTGTACAGTA Gene: y0881: Recombinase A |
*
Serratia proteamaculans 568 Site: position = -100 score = 5.80015 sequence = TACTGTATGACCATACAGTA Gene: Spro_0841: Recombinase A |
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -101 score = 5.73902 sequence = TGCTGTATGTGTATACAGTA Gene: ECA3369: Recombinase A |
*
Edwardsiella tarda EIB202 Site: position = -63 score = 5.74781 sequence = TACTGTATGAGCATACAGTA Gene: ETAE_2861: Recombinase A |
*
Proteus mirabilis HI4320 Site: position = -102 score = 6.06979 sequence = TACTGTATGATTATACAGTA Gene: PMI0375: Recombinase A |
*
Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -100 score = 5.83612 sequence = TGCTGTATGATTATACAGTA Gene: plu1249: Recombinase A |
Recombinase A |
| recX |
Gene: b2698: regulatory protein RecX |
Gene: STM2828: regulatory protein RecX |
Gene: CKO_04049: regulatory protein RecX |
Gene: KPN_03030: regulatory protein RecX |
Gene: Ent638_3173: regulatory protein RecX |
Gene: EAM_2639: regulatory protein RecX |
Gene: y0882: regulatory protein RecX |
Gene: Spro_0842: regulatory protein RecX |
Gene: ECA3368: regulatory protein RecX |
Gene: ETAE_2860: regulatory protein RecX |
Gene: PMI2663: regulatory protein RecX |
Gene: plu3294: regulatory protein RecX |
regulatory protein RecX |
| CRON 5. | |||||||||||||
| dinB |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -34 score = 4.75357 sequence = CACTGTATACTTTACCAGTG Gene: b0231: DNA polymerase IV (EC 2.7.7.7) |
*
Salmonella typhimurium LT2 Site: position = -35 score = 5.39505 sequence = TACTGTACACTTAAACAGTA Gene: STM0313: DNA polymerase IV (EC 2.7.7.7) |
*
Citrobacter koseri ATCC BAA-895 Site: position = -35 score = 5.83071 sequence = TACTGTATACTTAAACAGTA Gene: CKO_02960: DNA polymerase IV (EC 2.7.7.7) |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = 1 score = 5.23262 sequence = TGCTGTATGGGTATACAGTG Gene: KPN_00247: DNA polymerase IV (EC 2.7.7.7) |
*
Enterobacter sp. 638 Site: position = -37 score = 5.7696 sequence = TACTGTATACTTATCCAGTA Gene: Ent638_0762: DNA polymerase IV (EC 2.7.7.7) |
*
Erwinia amylovora ATCC 49946 Site: position = -36 score = 5.42326 sequence = GACTGTATACTTATCCAGTA Gene: EAM_0894: DNA polymerase IV (EC 2.7.7.7) |
*
Yersinia pestis KIM Site: position = -41 score = 5.27383 sequence = GACTGTATACTTATACAGCT Gene: y0959: DNA polymerase IV (EC 2.7.7.7) |
*
Serratia proteamaculans 568 Site: position = -35 score = 5.71168 sequence = GCCTGTATATTTATACAGTA Gene: Spro_0962: DNA polymerase IV (EC 2.7.7.7) |
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -36 score = 5.53221 sequence = ATCTGTATATTCATACAGTA Gene: ECA3468: DNA polymerase IV (EC 2.7.7.7) |
*
Edwardsiella tarda EIB202 Site: position = -42 score = 5.63109 sequence = TGCTGTATACTCATACAGTA Gene: ETAE_0788: DNA polymerase IV (EC 2.7.7.7) |
*
Proteus mirabilis HI4320 Site: position = -39 score = 6.14366 sequence = TACTGTATATTTAAACAGTA Gene: PMI0362: DNA polymerase IV (EC 2.7.7.7) |
*
Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -42 score = 4.84273 sequence = TTATGTATGTTTATACAGTT Gene: plu1239: DNA polymerase IV (EC 2.7.7.7) |
DNA polymerase IV (EC 2.7.7.7) |
| CRON 6. | |||||||||||||
| lexA |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -47 score = 5.14368 sequence = TGCTGTATATACTCACAGCA Site: position = -26 score = 5.16198 sequence = AACTGTATATACACCCAGGG Gene: b4043: LexA repressor |
*
Salmonella typhimurium LT2 Site: position = -47 score = 5.24946 sequence = AACTGTATATACTCACAGCA Site: position = -26 score = 4.4354 sequence = GATTGTATATACACCCAGGG Gene: STM4237: LexA repressor |
*
Citrobacter koseri ATCC BAA-895 Site: position = -47 score = 5.01579 sequence = AGCTGTATATACTCACAGCA Site: position = -26 score = 5.16198 sequence = AACTGTATATACACCCAGGG Gene: CKO_03872: LexA repressor |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -47 score = 5.01579 sequence = AGCTGTATATACTCACAGCA Site: position = -26 score = 5.16198 sequence = AACTGTATATACACCCAGGG Gene: KPN_04431: LexA repressor |
*
Enterobacter sp. 638 Site: position = -47 score = 5.03101 sequence = GACTGTATATACTCACAGCA Site: position = -26 score = 5.16198 sequence = AACTGTATATACACCCAGGG Gene: Ent638_0247: LexA repressor |
*
Erwinia amylovora ATCC 49946 Site: position = -46 score = 4.90015 sequence = ACCTGTATATACTCACAGTC Site: position = -26 score = 4.98578 sequence = GACTGTATAAACAACCAGGG Gene: EAM_0264: LexA repressor |
*
Yersinia pestis KIM Site: position = -47 score = 5.01579 sequence = AGCTGTATATACTCACAGCA Site: position = -26 score = 5.41636 sequence = AACTGTATAAACAAACAGGG Gene: y0572: LexA repressor |
*
Serratia proteamaculans 568 Site: position = -47 score = 5.01281 sequence = ACCTGTATATACTCACAGCA Site: position = -26 score = 5.19791 sequence = GACTGTATAAACAAACAGGG Gene: Spro_4460: LexA repressor |
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -47 score = 5.01281 sequence = ACCTGTATATACTCACAGCA Site: position = -26 score = 4.98578 sequence = GACTGTATAAACAACCAGGG Gene: ECA0630: LexA repressor |
*
Edwardsiella tarda EIB202 Site: position = -47 score = 5.01281 sequence = ACCTGTATATACTCACAGCA Site: position = -26 score = 4.9807 sequence = AACTGTATAAACGAACAGGG Gene: ETAE_0230: LexA repressor |
*
Proteus mirabilis HI4320 Site: position = -47 score = 4.90015 sequence = ACCTGTATATACTCACAGTC Site: position = -26 score = 5.19791 sequence = GACTGTATAAACAAACAGGG Gene: PMI2749: LexA repressor |
*
Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -26 score = 5.19791 sequence = GACTGTATAAACAAACAGGG Gene: plu4374: LexA repressor |
SOS-response repressor and protease LexA (EC 3.4.21.88) |
| dinF |
Gene: b4044: DNA-damage-inducible SOS response protein |
Gene: STM4238: DNA-damage-inducible SOS response protein |
Gene: CKO_03870: DNA-damage-inducible SOS response protein |
Gene: KPN_04432: DNA-damage-inducible SOS response protein |
Gene: Ent638_0248: DNA-damage-inducible SOS response protein |
Gene: EAM_0265: DNA-damage-inducible SOS response protein |
|
Gene: Spro_4459: DNA-damage-inducible SOS response protein |
|
Gene: ETAE_0231: DNA-damage-inducible SOS response protein |
|
|
DNA-damage-inducible SOS response protein |
| CRON 7. | |||||||||||||
| ftsK |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -96 score = 5.03028 sequence = TCCTGTTAATCCATACAGCA Gene: b0890: DNA translocase FtsK |
*
Salmonella typhimurium LT2 Site: position = -96 score = 5.03028 sequence = TCCTGTTAATCCATACAGCA Gene: STM0960: DNA translocase FtsK |
*
Citrobacter koseri ATCC BAA-895 Site: position = -39 score = 5.03028 sequence = TCCTGTTAATCCATACAGCA Gene: CKO_02181: DNA translocase FtsK |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -97 score = 5.03028 sequence = TCCTGTTAATCCATACAGCA Gene: KPN_00922: DNA translocase FtsK |
*
Enterobacter sp. 638 Site: position = -96 score = 5.03028 sequence = TCCTGTTAATCCATACAGCA Gene: Ent638_1414: DNA translocase FtsK |
*
Erwinia amylovora ATCC 49946 Site: position = -80 score = 4.90191 sequence = TCCTGTGAATTCATACAGGT Gene: EAM_1329: DNA translocase FtsK |
*
Yersinia pestis KIM Site: position = -86 score = 5.66216 sequence = TCCTGTTTATTCATACAGTT Gene: y2800: DNA translocase FtsK |
*
Serratia proteamaculans 568 Site: position = -85 score = 5.66216 sequence = TCCTGTTTATTCATACAGTT Gene: Spro_1683: DNA translocase FtsK |
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -78 score = 5.03707 sequence = TCCTGTGAATTTATACAGTC Gene: ECA2647: DNA translocase FtsK |
*
Edwardsiella tarda EIB202 Site: position = -114 score = 5.42392 sequence = TCCTGTGTATGTATACAGTT Gene: ETAE_2199: DNA translocase FtsK |
*
Proteus mirabilis HI4320 Site: position = -83 score = 5.5741 sequence = TCCTGTTTATGTATACAGTT Gene: PMI0697: DNA translocase FtsK |
*
Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -81 score = 5.45714 sequence = TCCTGTTTATGCATACAGTT Gene: plu1601: DNA translocase FtsK |
DNA translocase FtsK |
| CRON 8. | |||||||||||||
| ydjM |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -52 score = 4.43806 sequence = CACTGTATAAAAATCCTATA Site: position = -34 score = 4.6848 sequence = TACTGTACGTATCGACAGTT Gene: b1728: membrane-bound metal-dependent hydrolase |
*
Salmonella typhimurium LT2 Site: position = -52 score = 4.38267 sequence = TACTGTATAAAAACCCTATA Site: position = -34 score = 5.16715 sequence = TACTGTATGAATTGACAGTT Gene: STM1321: membrane-bound metal-dependent hydrolase |
*
Citrobacter koseri ATCC BAA-895 Site: position = -52 score = 4.38267 sequence = TACTGTATAAAAACCCTATA Site: position = -34 score = 5.16715 sequence = TACTGTATGAATTGACAGTT Gene: CKO_01754: membrane-bound metal-dependent hydrolase |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -34 score = 5.01253 sequence = TACTGTATGAATCGACAGTT Gene: KPN_01239: membrane-bound metal-dependent hydrolase |
*
Enterobacter sp. 638 Site: position = -34 score = 5.16715 sequence = TACTGTATGAATTGACAGTT Gene: Ent638_1715: membrane-bound metal-dependent hydrolase |
*
Erwinia amylovora ATCC 49946 Site: position = -56 score = 4.31486 sequence = TACTGTATATATTCCCTATA Site: position = -38 score = 4.75 sequence = TACTGGATGCATTGACAGTT Gene: EAM_1619: membrane-bound metal-dependent hydrolase |
*
Yersinia pestis KIM Site: position = -39 score = 5.04193 sequence = TACTGGATAAATCAACAGCT Gene: y1879: membrane-bound metal-dependent hydrolase |
*
Serratia proteamaculans 568 Site: position = -39 score = 5.43022 sequence = TACTGGATAAATTAACAGTT Gene: Spro_2124: membrane-bound metal-dependent hydrolase |
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -36 score = 5.44466 sequence = TACTGTATAAAATAACAGTT Gene: ECA2409: membrane-bound metal-dependent hydrolase |
*
Edwardsiella tarda EIB202 Site: position = -109 score = 5.54338 sequence = TTCTGTATATTTATACAGCA Gene: ETAE_1569: membrane-bound metal-dependent hydrolase |
*
Proteus mirabilis HI4320 Site: position = -54 score = 5.22853 sequence = CACTGTATAAATGAACAGCA Gene: PMI1020: membrane-bound metal-dependent hydrolase |
*
Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -37 score = 5.04156 sequence = GACTGTATGGATAGACAGTT Gene: plu2679: membrane-bound metal-dependent hydrolase |
membrane-bound metal-dependent hydrolase |
| CRON 9. | |||||||||||||
| recN |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -68 score = 5.71388 sequence = TACTGTATATAAAACCAGTT Site: position = -46 score = 4.93187 sequence = TACTGTACACAATAACAGTA Site: position = -28 score = 4.69075 sequence = TAATGGTTTTTCATACAGGA Gene: b2616: DNA repair protein RecN |
*
Salmonella typhimurium LT2 Site: position = -68 score = 5.60596 sequence = TACTGTATAAAAAACCAGTT Site: position = -46 score = 5.28746 sequence = TACTGTATTTAATTACAGTC Site: position = -28 score = 4.4541 sequence = TCATGGTTTTTCATACAGGA Gene: STM2684: DNA repair protein RecN |
*
Citrobacter koseri ATCC BAA-895 Site: position = -68 score = 5.60596 sequence = TACTGTATAAAAAACCAGTT Site: position = -46 score = 5.067 sequence = TACTGTATGTAATCACAGTC Site: position = -28 score = 4.4541 sequence = TCATGGTTTTTCATACAGGA Gene: CKO_03938: DNA repair protein RecN |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -68 score = 5.17538 sequence = TACTGGATAAAAAACCAGTC Site: position = -46 score = 5.24317 sequence = TACTGTACGAAAACACAGTA Site: position = -28 score = 4.87211 sequence = TATTGGTTTTTCATACAGGA Gene: KPN_02938: DNA repair protein RecN |
*
Enterobacter sp. 638 Site: position = -68 score = 5.60596 sequence = TACTGTATAAAAAACCAGTT Site: position = -46 score = 5.81642 sequence = TACTGTATAGAAATACAGTT Gene: Ent638_3096: DNA repair protein RecN |
*
Erwinia amylovora ATCC 49946 Site: position = -68 score = 5.69075 sequence = TACTGTTTATAAAACCAGTA Site: position = -46 score = 4.2819 sequence = TACTGTATGAAAAACCATAT Site: position = -28 score = 4.79668 sequence = ATCTGTGTTTTCATACAGGA Gene: EAM_2529: DNA repair protein RecN |
*
Yersinia pestis KIM Site: position = 39 score = 5.49543 sequence = TACTGTATATAAAACCAGTC Site: position = 61 score = 4.52913 sequence = TACTGTGTTCAAATACAGAC Gene: y3075: DNA repair protein RecN |
*
Serratia proteamaculans 568 Site: position = -68 score = 5.49543 sequence = TACTGTATATAAAACCAGTC Site: position = -46 score = 5.02291 sequence = TACTGTATGAAACCACAGTT Site: position = -28 score = 4.45997 sequence = TTATGTATTTATACACAGGA Gene: Spro_3686: DNA repair protein RecN |
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -61 score = 5.71388 sequence = TACTGTATATAAAACCAGTT Site: position = -39 score = 5.44042 sequence = TACTGTATGTAAACACAGTC Gene: ECA0840: DNA repair protein RecN |
*
Edwardsiella tarda EIB202 Site: position = -68 score = 5.60596 sequence = TACTGTATAAAAAACCAGTT Site: position = -46 score = 4.61122 sequence = TACTGGCATTAAACACAGTA Gene: ETAE_2737: DNA repair protein RecN |
*
Proteus mirabilis HI4320 Site: position = -66 score = 5.60596 sequence = TACTGTATAAAAAACCAGTT Site: position = -44 score = 5.06902 sequence = TACTGTATGTAATTACAGAT Gene: PMI1902: DNA repair protein RecN |
*
Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -68 score = 5.60596 sequence = TACTGTATAAAAAACCAGTT Site: position = -46 score = 4.83985 sequence = TACTGTATGAAGATACAGAG Site: position = -28 score = 4.50938 sequence = AGGTGTTTTTATACACAGGA Gene: plu3374: DNA repair protein RecN |
DNA repair protein RecN |
| CRON 10. | |||||||||||||
| uvrB |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -94 score = 5.60596 sequence = AACTGTTTTTTTATCCAGTA Gene: b0779: Excinuclease ABC subunit B |
*
Salmonella typhimurium LT2 Site: position = -93 score = 5.61688 sequence = TACTGTTTTTTCATCCAGTA Gene: STM0798: Excinuclease ABC subunit B |
*
Citrobacter koseri ATCC BAA-895 Site: position = -93 score = 5.37108 sequence = CACTGTTTTTTCATCCAGTA Gene: CKO_02348: Excinuclease ABC subunit B |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -95 score = 5.68573 sequence = CACTGTTTAAATATCCAGTA Gene: KPN_00804: Excinuclease ABC subunit B |
*
Enterobacter sp. 638 Site: position = -95 score = 5.41789 sequence = CACTGGATTTACATCCAGTA Gene: Ent638_1271: Excinuclease ABC subunit B |
*
Erwinia amylovora ATCC 49946 Site: position = -96 score = 4.71081 sequence = AGCTGTGATTATATCCAGTG Gene: EAM_1216: Excinuclease ABC subunit B |
*
Yersinia pestis KIM Site: position = -97 score = 5.26808 sequence = AGCTGGTTTTATATCCAGTA Gene: y3026: Excinuclease ABC subunit B |
*
Serratia proteamaculans 568 Site: position = -130 score = 5.26808 sequence = AGCTGGTTTTATATCCAGTA Gene: Spro_1317: Excinuclease ABC subunit B |
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -232 score = 5.60809 sequence = TgCTGTtTtTATATcCAGTA Gene: ECA2820: Excinuclease ABC subunit B |
*
Edwardsiella tarda EIB202 Site: position = -106 score = 5.20766 sequence = AGCTGGGTAAATATCCAGTA Gene: ETAE_2547: Excinuclease ABC subunit B |
*
Proteus mirabilis HI4320 Site: position = -51 score = 5.31117 sequence = AGCTGGATTTTTATCCAGTA Gene: PMI0607: Excinuclease ABC subunit B |
*
Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -56 score = 5.26808 sequence = AGCTGGTTTTATATCCAGTA Gene: plu1491: Excinuclease ABC subunit B |
Excinuclease ABC subunit B |
| CRON 11. | |||||||||||||
| ruvA |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -69 score = 5.0046 sequence = CGCTGGATATCTATCCAGCA Gene: b1861: Holliday junction helicase subunit A |
*
Salmonella typhimurium LT2 Site: position = -71 score = 4.76161 sequence = ATCTGGATAAACATCCAGTC Gene: STM1895: Holliday junction helicase subunit A |
*
Citrobacter koseri ATCC BAA-895 Site: position = -70 score = 4.55772 sequence = GGCTGGATATCTATCCAGCC Gene: CKO_01099: Holliday junction helicase subunit A |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -69 score = 4.55772 sequence = GGCTGGATATCTATCCAGCC Gene: KPN_02376: Holliday junction helicase subunit A |
*
Enterobacter sp. 638 Site: position = -69 score = 4.59343 sequence = GGCTGGATAAACATCCAGCC Gene: Ent638_2430: Holliday junction helicase subunit A |
*
Erwinia amylovora ATCC 49946 Site: position = -68 score = 4.99462 sequence = AGCTGGATATCTATCCAGCT Gene: EAM_2004: Holliday junction helicase subunit A |
*
Yersinia pestis KIM Site: position = -244 score = 4.44076 sequence = GGCTGGATATCCATCCAGCC Gene: y2253: Holliday junction helicase subunit A |
*
Serratia proteamaculans 568 Site: position = -91 score = 4.59343 sequence = GGCTGGATATTCATCCAGCC Gene: Spro_2777: Holliday junction helicase subunit A |
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -84 score = 4.93977 sequence = TGCTGGATATTCATCCAGCC Gene: ECA2492: Holliday junction helicase subunit A |
*
Edwardsiella tarda EIB202 Site: position = -74 score = 4.59343 sequence = GGCTGGATATTCATCCAGCC Gene: ETAE_1439: Holliday junction helicase subunit A |
*
Proteus mirabilis HI4320 Site: position = -68 score = 4.48415 sequence = GGCTGGATATACGTCCAGCT Gene: PMI1115: Holliday junction helicase subunit A |
*
Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -85 score = 4.60686 sequence = GGCTGGATATGCATCCAGCT Gene: plu2111: Holliday junction helicase subunit A |
Holliday junction helicase subunit A |
| ruvB |
Gene: b1860: Holliday junction DNA helicase B |
Gene: STM1894: Holliday junction DNA helicase B |
Gene: CKO_01101: Holliday junction DNA helicase B |
Gene: KPN_02375: Holliday junction DNA helicase B |
Gene: Ent638_2429: Holliday junction DNA helicase B |
Gene: EAM_2003: Holliday junction DNA helicase B |
Gene: y2252: Holliday junction DNA helicase B |
Gene: Spro_2776: Holliday junction DNA helicase B |
Gene: ECA2491: Holliday junction DNA helicase B |
Gene: ETAE_1440: Holliday junction DNA helicase B |
Gene: PMI1116: Holliday junction DNA helicase B |
Gene: plu2112: Holliday junction DNA helicase B |
Holliday junction DNA helicase B |
| CRON 12. | |||||||||||||
| yebG |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -37 score = 5.29448 sequence = TACTGTATAAAATCACAGTT Gene: b1848: SOS regulon DNA damage-inducible protein |
*
Salmonella typhimurium LT2 Site: position = -37 score = 5.53918 sequence = TACTGTATATAAACACAGGT Gene: STM1882: SOS regulon DNA damage-inducible protein |
*
Citrobacter koseri ATCC BAA-895 Site: position = -38 score = 4.79762 sequence = TGCTGTACATAATTACAGGT Gene: CKO_01118: SOS regulon DNA damage-inducible protein |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -35 score = 5.85118 sequence = TACTGTATAAAAATACAGTG Gene: KPN_02363: SOS regulon DNA damage-inducible protein |
*
Enterobacter sp. 638 Site: position = -33 score = 5.33989 sequence = CACTGTATATAATTACAGTG Gene: Ent638_1887: SOS regulon DNA damage-inducible protein |
*
Erwinia amylovora ATCC 49946 Site: position = -35 score = 5.6679 sequence = TACTGTATAAAAACACAGTT Gene: EAM_1993: SOS regulon DNA damage-inducible protein |
*
Yersinia pestis KIM Site: position = -47 score = 5.15661 sequence = CACTGTGATTATATACAGTT Gene: y2530: SOS regulon DNA damage-inducible protein |
*
Serratia proteamaculans 568 Site: position = -44 score = 6.09698 sequence = TACTGTATAAAAATACAGTA Gene: Spro_2803: SOS regulon DNA damage-inducible protein |
|
*
Edwardsiella tarda EIB202 Site: position = -31 score = 5.8081 sequence = TACTGTATATAAAAACAGTG Gene: ETAE_1833: SOS regulon DNA damage-inducible protein |
|
|
SOS regulon DNA damage-inducible protein |
| CRON 13. | |||||||||||||
| dinG |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -34 score = 4.94821 sequence = TATTGGCTGTTTATACAGTA Gene: b0799: ATP-dependent helicase DinG/Rad3 |
*
Salmonella typhimurium LT2 Site: position = -34 score = 4.81122 sequence = TAGTGGCTGTTTATACAGTA Gene: STM0821: ATP-dependent helicase DinG/Rad3 |
*
Citrobacter koseri ATCC BAA-895 Site: position = -34 score = 4.81122 sequence = TAGTGGCTGTTTATACAGTA Gene: CKO_02329: ATP-dependent helicase DinG/Rad3 |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -33 score = 4.81122 sequence = TAGTGGCTGTTTATACAGTA Gene: KPN_00831: ATP-dependent helicase DinG/Rad3 |
*
Enterobacter sp. 638 Site: position = -34 score = 4.81122 sequence = TAGTGGCTGTTTATACAGTA Gene: Ent638_1289: ATP-dependent helicase DinG/Rad3 |
*
Erwinia amylovora ATCC 49946 Site: position = -43 score = 4.78012 sequence = TACTGTGCAAAAATACAGCC Gene: EAM_1250: ATP-dependent helicase DinG/Rad3 |
Gene: y2982: ATP-dependent helicase DinG/Rad3 |
Gene: Spro_1461: ATP-dependent helicase DinG/Rad3 |
Gene: ECA2786: ATP-dependent helicase DinG/Rad3 |
Gene: ETAE_1175: ATP-dependent helicase DinG/Rad3 |
Gene: PMI0630: ATP-dependent helicase DinG/Rad3 |
Gene: plu1524: ATP-dependent helicase DinG/Rad3 |
ATP-dependent helicase DinG/Rad3 |
| CRON 14. | |||||||||||||
| polB |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -73 score = 4.3414 sequence = GACTGTATAAAACCACAGCC Gene: b0060: DNA polymerase II (EC 2.7.7.7) |
*
Salmonella typhimurium LT2 Site: position = -73 score = 4.5539 sequence = gcCTGTAcAaAataACAGTA Gene: STM0097: DNA polymerase II (EC 2.7.7.7) |
*
Citrobacter koseri ATCC BAA-895 Site: position = -73 score = 4.66954 sequence = ACCTGTATAAAACCACAGCA Gene: CKO_03322: DNA polymerase II (EC 2.7.7.7) |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -75 score = 4.21162 sequence = ACCTGTATAAAACCCCAGCG Gene: KPN_00059: DNA polymerase II (EC 2.7.7.7) |
*
Enterobacter sp. 638 Site: position = 30 score = 4.61203 sequence = ACCTGTATAAAATCCCAGCA Gene: Ent638_0607: DNA polymerase II (EC 2.7.7.7) |
*
Erwinia amylovora ATCC 49946 Site: position = -53 score = 4.87119 sequence = TACTGTATAAATAAACATGC Gene: EAM_0673: DNA polymerase II (EC 2.7.7.7) |
Gene: y3655: DNA polymerase II (EC 2.7.7.7) |
Gene: Spro_0731: DNA polymerase II (EC 2.7.7.7) |
Gene: ECA3852: DNA polymerase II (EC 2.7.7.7) |
Gene: ETAE_0607: DNA polymerase II (EC 2.7.7.7) |
Gene: PMI2327: DNA polymerase II (EC 2.7.7.7) |
|
DNA polymerase II (EC 2.7.7.7) |
| CRON 15. | |||||||||||||
| cho |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -33 score = 5.08726 sequence = CACTGGATAGATAACCAGCA Gene: b1741: endonuclease of nucleotide excision repair |
*
Salmonella typhimurium LT2 Site: position = -6 score = 5.47456 sequence = TACTGGATGAATAACCAGTT Gene: STM1309: endonuclease of nucleotide excision repair |
|
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -32 score = 5.30365 sequence = TACTGGATGGATAGACAGTA Gene: KPN_01227: endonuclease of nucleotide excision repair |
*
Enterobacter sp. 638 Site: position = -33 score = 5.04893 sequence = CACTGTATAGCTGAACAGTA Gene: Ent638_1703: endonuclease of nucleotide excision repair |
*
Erwinia amylovora ATCC 49946 Site: position = -33 score = 5.28735 sequence = TACTGTTCGGATAAACAGTA Gene: EAM_1613: endonuclease of nucleotide excision repair |
|
|
|
|
|
|
endonuclease of nucleotide excision repair |
| CRON 16. | |||||||||||||
| tag |
Gene: b3549: DNA-3-methyladenine glycosylase I |
Gene: STM3642: DNA-3-methyladenine glycosylase I |
Gene: CKO_04999: DNA-3-methyladenine glycosylase I |
Gene: KPN_03907: DNA-3-methyladenine glycosylase I |
Gene: Ent638_0175: DNA-3-methyladenine glycosylase I |
Gene: EAM_3433: DNA-3-methyladenine glycosylase I |
Gene: y4091: DNA-3-methyladenine glycosylase I |
*
Serratia proteamaculans 568 Site: position = -34 score = 5.29662 sequence = TACTGTAAATAAACACAGCA Gene: Spro_0064: DNA-3-methyladenine glycosylase I |
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -115 score = 4.89641 sequence = CGCTGGTTGCATATACAGCA Gene: ECA0082: DNA-3-methyladenine glycosylase I |
Gene: ETAE_0014: DNA-3-methyladenine glycosylase I |
*
Proteus mirabilis HI4320 Site: position = -78 score = 4.74178 sequence = ACATGTGTTTTTATACAGTA Gene: PMI2853: DNA-3-methyladenine glycosylase I |
*
Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -65 score = 5.14145 sequence = ACTTGTATATCTATACAGTT Gene: plu0292: DNA-3-methyladenine glycosylase I |
DNA-3-methyladenine glycosylase I |
| CRON 17. | |||||||||||||
| mug |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -69 score = 4.91529 sequence = TGCTGTTTTTATAAACAATG Gene: b3068: DNA glycosylase, G/U mismatch specific |
*
Salmonella typhimurium LT2 Site: position = -70 score = 4.91529 sequence = TGCTGTTTTTATAAACAATG Gene: STM3212: DNA glycosylase, G/U mismatch specific |
*
Citrobacter koseri ATCC BAA-895 Site: position = -70 score = 4.68162 sequence = TGCTGTTTTTATAAACAACG Gene: CKO_04467: DNA glycosylase, G/U mismatch specific |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -69 score = 4.91529 sequence = TGCTGTTTTTATAAACAATG Gene: KPN_03475: DNA glycosylase, G/U mismatch specific |
*
Enterobacter sp. 638 Site: position = -70 score = 4.91529 sequence = TGCTGTTTTTATAAACAATG Gene: Ent638_3474: DNA glycosylase, G/U mismatch specific |
Gene: EAM_3006: DNA glycosylase, G/U mismatch specific |
|
Gene: Spro_4301: DNA glycosylase, G/U mismatch specific |
Gene: ECA0679: DNA glycosylase, G/U mismatch specific |
Gene: ETAE_0453: DNA glycosylase, G/U mismatch specific |
|
|
DNA glycosylase, G/U mismatch specific |
| CRON 18. | |||||||||||||
| uvrA |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -103 score = 5.45345 sequence = TACTGTATATTCATTCAGGT Gene: b4058: excinuclease ABC subunit A |
*
Salmonella typhimurium LT2 Site: position = -100 score = 5.66216 sequence = TACTGTATATTCAAACAGGT Gene: STM4254: excinuclease ABC subunit A |
*
Citrobacter koseri ATCC BAA-895 Site: position = -102 score = 5.30078 sequence = TACTGTATATCCATTCAGGT Gene: CKO_03843: excinuclease ABC subunit A |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -105 score = 5.45345 sequence = TACTGTATATTCATTCAGGT Gene: KPN_04445: excinuclease ABC subunit A |
*
Enterobacter sp. 638 Site: position = -100 score = 5.66216 sequence = TACTGTATATTCAAACAGGT Gene: Ent638_0261: excinuclease ABC subunit A |
*
Erwinia amylovora ATCC 49946 Site: position = -101 score = 4.47338 sequence = CACTGGTTATCCATTCAGGC Gene: EAM_0307: excinuclease ABC subunit A |
*
Yersinia pestis KIM Site: position = -318 score = 4.84285 sequence = CACTGGATATCCATTCAGGT Gene: y0580: excinuclease ABC subunit A |
*
Serratia proteamaculans 568 Site: position = -140 score = 5.24132 sequence = TACTGGATATTCATTCAGGT Gene: Spro_4440: excinuclease ABC subunit A |
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -107 score = 5.47797 sequence = TACTGGATATTCATTCAGTT Gene: ECA3689: excinuclease ABC subunit A |
*
Edwardsiella tarda EIB202 Site: position = -92 score = 5.3253 sequence = TACTGGATATCCATTCAGTT Gene: ETAE_3184: excinuclease ABC subunit A |
*
Proteus mirabilis HI4320 Site: position = -84 score = 5.30376 sequence = TACTGTATATCCATTCAGCT Gene: PMI2746: excinuclease ABC subunit A |
*
Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -209 score = 5.28492 sequence = TACTGTATATCTAATCAGTC Gene: plu4350: excinuclease ABC subunit A |
excinuclease ABC subunit A |
| CRON 19. | |||||||||||||
| dinI |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -39 score = 5.56699 sequence = ACCTGTATAAATAACCAGTA Gene: b1061: DNA damage-inducible protein |
*4
Salmonella typhimurium LT2 Site: position = -39 score = 6.06258 sequence = AACTGTATATATATCCAGTA Gene: STM1162: DNA damage-inducible protein Site: position = -35 score = 6.00674 sequence = TACTGTATATACAAACAGTT Gene: STM1056: DNA damage-inducible protein Site: position = -39 score = 5.65792 sequence = TACTGTGTTTATATACAGTG Gene: STM2621: DNA damage-inducible protein Site: position = -39 score = 5.65792 sequence = TACTGTGTTTATATACAGTG Gene: STM1019: DNA damage-inducible protein |
*2
Citrobacter koseri ATCC BAA-895 Site: position = -39 score = 5.86559 sequence = AACTGTATAAATACACAGTA Gene: CKO_02002: DNA damage-inducible protein Site: position = -25 score = 6.09698 sequence = TACTGTATAaAaATACAGTA Gene: CKO_01890: DNA damage-inducible protein |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -39 score = 5.93153 sequence = TACTGTATAAATAACCAGTA Gene: KPN_01073: DNA damage-inducible protein |
*3
Enterobacter sp. 638 Site: position = -39 score = 5.79732 sequence = GACTGTATAAATAAACAGTA Gene: Ent638_1575: DNA damage-inducible protein Site: position = -32 score = 5.69234 sequence = TGCTGTATATAAAAACAGTT Gene: Ent638_1656: DNA damage-inducible protein Site: position = -38 score = 5.48533 sequence = CACTGTATAAATGTACAGTT Gene: Ent638_2256: DNA damage-inducible protein |
*
Erwinia amylovora ATCC 49946 Site: position = -38 score = 5.7734 sequence = AACTGTATATATTTACAGTT Gene: EAM_1429: DNA damage-inducible protein |
*
Yersinia pestis KIM Site: position = -41 score = 6.14366 sequence = TACTGTATAAATAAACAGTA Gene: y1747: DNA damage-inducible protein |
*
Serratia proteamaculans 568 Site: position = -39 score = 5.95466 sequence = AACTGTATAAATATCCAGTA Gene: Spro_1895: DNA damage-inducible protein |
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -38 score = 5.88789 sequence = AACTGTATAAATAAACAGTT Gene: ECA1786: DNA damage-inducible protein |
*
Edwardsiella tarda EIB202 Site: position = -42 score = 5.66762 sequence = AGCTGTATATATTTACAGTA Gene: ETAE_2072: DNA damage-inducible protein |
*
Proteus mirabilis HI4320 Site: position = -45 score = 6.07702 sequence = TACTGTATTTATATACAGTT Gene: PMI1958: DNA damage-inducible protein |
*
Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -65 score = 5.66491 sequence = TACTGTTTATATGAACAGTA Gene: plu1815: DNA damage-inducible protein |
DNA damage-inducible protein |
| CRON 20. | |||||||||||||
| tisB |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -254 score = 6.14366 sequence = TACTGTTTATTTATACAGTA Gene: b4618: lexA-regulated toxic peptide |
|
|
|
|
|
|
|
|
|
|
|
lexA-regulated toxic peptide |
| CRON 21. | |||||||||||||
| sbmC |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -34 score = 6.0539 sequence = TACTGTATATAAAAACAGTA Gene: b2009: DNA gyrase inhibitor |
*
Salmonella typhimurium LT2 Site: position = -41 score = 5.50838 sequence = TACTGTACATTCATACAGCA Gene: STM2061: DNA gyrase inhibitor |
*
Citrobacter koseri ATCC BAA-895 Site: position = -157 score = 5.67004 sequence = TGCTGTGTTTATATACAGTA Gene: CKO_00775: DNA gyrase inhibitor |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -42 score = 5.81615 sequence = AGCTGTATATTCATACAGTA Gene: KPN_02467: DNA gyrase inhibitor |
*
Enterobacter sp. 638 Site: position = -35 score = 5.34837 sequence = TAGTGTATAAATACACAGTA Gene: Ent638_2577: DNA gyrase inhibitor |
|
|
Gene: Spro_3021: DNA gyrase inhibitor |
|
Gene: ETAE_1076: DNA gyrase inhibitor |
|
|
DNA gyrase inhibitor |
| CRON 22. | |||||||||||||
| dinD |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -63 score = 5.94914 sequence = AACTGTATATAAATACAGTT Gene: b3645: DNA-damage-inducible protein |
|
|
Gene: KPN_04089: DNA-damage-inducible protein |
|
|
|
|
|
|
|
|
DNA-damage-inducible protein |
| CRON 23. | |||||||||||||
| dinQ |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -188 score = 4.31841 sequence = TGCTGGTTTTATAACCTGCA Site: position = -166 score = 5.72977 sequence = TACTGTATGATTATCCAGTT Gene: b4613: Damage inducible, function unknown |
|
|
|
|
|
|
|
|
|
|
|
Damage inducible, function unknown |
| CRON 24. | |||||||||||||
| impA |
|
|
|
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -44 score = 5.60955 sequence = TACTGTATGCATAACCAGTA Gene: KPN_pKPN5p08226: ImpA-like protein; UV protection |
|
|
|
|
|
|
|
|
ImpA-like protein; UV protection |
| KPN_pKPN5p08225 |
|
|
|
Gene: KPN_pKPN5p08225: mutagenesis by UV and mutagens |
|
|
|
|
|
|
|
|
mutagenesis by UV and mutagens |
| CRON 25. | |||||||||||||
| PMI3143 |
|
|
|
|
|
|
|
|
|
|
*
Proteus mirabilis HI4320 Site: position = -25 score = 5.56147 sequence = AACTGTTTTTATATACAGGT Gene: PMI3143: DNA modification methyltransferase |
|
DNA modification methyltransferase |
| PMI3142 |
|
|
|
|
|
|
|
|
|
|
Gene: PMI3142: DNA modification methyltransferase |
|
DNA modification methyltransferase |
| PMI3141 |
|
|
|
|
|
|
|
|
|
|
Gene: PMI3141: restriction endonuclease |
|
restriction endonuclease |
| CRON 26. | |||||||||||||
| ssb |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -170 score = 5.45345 sequence = ACCTGAATGAATATACAGTA Gene: b4059: single-strand binding protein |
*
Salmonella typhimurium LT2 Site: position = -167 score = 5.66216 sequence = ACCTGTTTGAATATACAGTA Gene: STM4256: single-strand binding protein |
*
Citrobacter koseri ATCC BAA-895 Site: position = -168 score = 5.30078 sequence = ACCTGAATGGATATACAGTA Gene: CKO_03842: single-strand binding protein |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -166 score = 5.45345 sequence = ACCTGAATGAATATACAGTA Gene: KPN_04446: single-strand binding protein |
*
Enterobacter sp. 638 Site: position = -165 score = 5.66216 sequence = ACCTGTTTGAATATACAGTA Gene: Ent638_0262: single-strand binding protein |
*
Erwinia amylovora ATCC 49946 Site: position = -171 score = 4.47338 sequence = GCCTGAATGGATAACCAGTG Gene: EAM_0308: single-strand binding protein |
*
Yersinia pestis KIM Site: position = -158 score = 4.84285 sequence = ACCTGAATGGATATCCAGTG Gene: y0582: single-strand binding protein |
*
Serratia proteamaculans 568 Site: position = -157 score = 5.24132 sequence = ACCTGAATGAATATCCAGTA Gene: Spro_4439: single-strand binding protein |
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -158 score = 5.47797 sequence = AACTGAATGAATATCCAGTA Gene: ECA3690: single-strand binding protein |
*
Edwardsiella tarda EIB202 Site: position = -155 score = 5.3253 sequence = AACTGAATGGATATCCAGTA Gene: ETAE_3183: single-strand binding protein |
*
Proteus mirabilis HI4320 Site: position = -188 score = 5.30376 sequence = AGCTGAATGGATATACAGTA Gene: PMI2747: single-strand binding protein |
*
Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -169 score = 5.28492 sequence = GACTGATTAGATATACAGTA Gene: plu4349: single-strand binding protein |
single-strand binding protein |
| CRON 27. | |||||||||||||
| yjiW |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -95 score = 4.99929 sequence = TACTGATGATATATACAGGT Gene: b4347: LexA regulated, putative SOS response |
*
Salmonella typhimurium LT2 Site: position = -94 score = 4.36594 sequence = TACTGATGTTATGTACAGGT Gene: STM4523: LexA regulated, putative SOS response |
|
|
|
|
|
|
|
|
|
|
LexA regulated, putative SOS response |
| CRON 28. | |||||||||||||
| ybfE |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -136 score = 4.46557 sequence = AACTGATTAAAAACCCAGCG Gene: b0685: LexA regulated protein |
Gene: STM0695: LexA regulated protein |
|
Gene: KPN_00708: LexA regulated protein |
Gene: Ent638_1200: LexA regulated protein |
Gene: EAM_1153: LexA regulated protein |
Gene: y1211: LexA regulated protein |
Gene: Spro_1238: LexA regulated protein |
|
Gene: ETAE_2608: LexA regulated protein |
Gene: PMI0545: LexA regulated protein |
Gene: plu1329: LexA regulated protein |
LexA regulated protein |
| CRON 29. | |||||||||||||
| samA |
|
*
Salmonella typhimurium LT2 Site: position = -37 score = 5.23723 sequence = TGCTGTATATAAAAACAGGC Gene: PSLT055: UV protection protein |
|
|
|
*
Erwinia amylovora ATCC 49946 Site: position = -35 score = 5.97269 sequence = TACTGTATATGCATACAGTA Gene: EAM_P216: UV protection protein |
|
|
|
|
|
|
UV protection protein |
| samB |
|
Gene: PSLT054: UV protection protein |
|
|
|
Gene: EAM_P215: UV protection protein |
|
|
|
|
|
|
UV protection protein |
| CRON 30. | |||||||||||||
| rmuC |
|
*
Salmonella typhimurium LT2 Site: position = -64 score = 5.16836 sequence = AACTGGACGTTTATACAGCA Gene: STM3969: DNA recombination protein RmuC |
*
Citrobacter koseri ATCC BAA-895 Site: position = -60 score = 5.16836 sequence = AACTGGACGTTTATACAGCA Gene: CKO_00174: DNA recombination protein RmuC |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -60 score = 4.7327 sequence = AACTGGACGTTTGTACAGCA Gene: KPN_04328: DNA recombination protein RmuC |
*
Enterobacter sp. 638 Site: position = -63 score = 5.16836 sequence = AACTGGACGTTTATACAGCA Gene: Ent638_3961: DNA recombination protein RmuC |
*
Erwinia amylovora ATCC 49946 Site: position = -64 score = 4.53713 sequence = GTCTGGACATTTATACAGTG Gene: EAM_0201: DNA recombination protein RmuC |
*
Yersinia pestis KIM Site: position = -62 score = 4.61383 sequence = CTCTGGACATCCATACAGTA Gene: y0448: DNA recombination protein RmuC |
*
Serratia proteamaculans 568 Site: position = -86 score = 4.79724 sequence = GACTGGACATCCATACAGCA Gene: Spro_0247: DNA recombination protein RmuC |
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -64 score = 4.85963 sequence = TTCTGGACATCCATACAGTA Gene: ECA0195: DNA recombination protein RmuC |
*
Edwardsiella tarda EIB202 Site: position = -63 score = 4.48595 sequence = CTCTGGACATCCATACAGTT Gene: ETAE_0146: DNA recombination protein RmuC |
Gene: PMI3535: DNA recombination protein RmuC |
*
Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -65 score = 4.97659 sequence = TTCTGGACATCTATACAGTA Gene: plu4414: DNA recombination protein RmuC |
DNA recombination protein RmuC |
| CRON 31. | |||||||||||||
| yafH |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -73 score = 4.26233 sequence = AAATGTTTTTACATCCACTA Gene: b0221: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
*
Salmonella typhimurium LT2 Site: position = -197 score = 3.76006 sequence = TACCGGATAGCAGTACAGGC Gene: STM0309: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
Gene: CKO_02965: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
Gene: KPN_00235: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
Gene: Ent638_0758: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
Gene: EAM_0890: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
Gene: y0946: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
Gene: Spro_0949: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
Gene: ECA3474: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
|
Gene: PMI0348: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
Gene: plu1192: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |