Statistics of regulated genes

Genome	Genes	Operons
Escherichia coli str. K-12 substr. MG1655	30	26
Salmonella typhimurium LT2	32	27
Citrobacter koseri ATCC BAA-895	22	21
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	27	22
Enterobacter sp. 638	27	23
Erwinia amylovora ATCC 49946	22	19
Yersinia pestis KIM	17	15
Serratia proteamaculans 568	18	16
Erwinia carotovora subsp. atroseptica SCRI1043	17	15
Edwardsiella tarda EIB202	18	15
Proteus mirabilis HI4320	20	16
Photorhabdus luminescens subsp. laumondii TTO1	16	15

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes													Function
CRON 1.
umuD	* Escherichia coli str. K-12 substr. MG1655 Site: position = -39 score = 6.0539 sequence = TACTGTATATAAAAACAGTA Gene: b1183: DNA polymerase V, subunit UmuD	* Salmonella typhimurium LT2 Site: position = -35 score = 6.0539 sequence = TACTGTATATAAAAACAGTA Gene: STM1998: DNA polymerase V, subunit UmuD	* Citrobacter koseri ATCC BAA-895 Site: position = -38 score = 5.89186 sequence = TACTGTATATATAATCAGTA Gene: CKO_01842: DNA polymerase V, subunit UmuD	* Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -40 score = 5.8081 sequence = TACTGTATATAAAAACAGTG Gene: KPN_01438: DNA polymerase V, subunit UmuD	* Enterobacter sp. 638 Site: position = -34 score = 5.93694 sequence = TACTGTATGTAAAAACAGTA Gene: Ent638_2213: DNA polymerase V, subunit UmuD	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202	* Proteus mirabilis HI4320 Site: position = -47 score = 6.14366 sequence = TACTGTATAAATAAACAGTA Gene: PMI2484: DNA polymerase V, subunit UmuD	Photorhabdus luminescens subsp. laumondii TTO1	DNA polymerase V, subunit UmuD
umuC	Escherichia coli str. K-12 substr. MG1655 Gene: b1184: DNA polymerase V, subunit UmuC	Salmonella typhimurium LT2 Gene: STM1997: DNA polymerase V, subunit UmuC	Citrobacter koseri ATCC BAA-895 Gene: CKO_01841: DNA polymerase V, subunit UmuC	Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Gene: KPN_01439: DNA polymerase V, subunit UmuC	Enterobacter sp. 638 Gene: Ent638_2212: DNA polymerase V, subunit UmuC	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202	Proteus mirabilis HI4320 Gene: PMI2485: DNA polymerase V, subunit UmuC	Photorhabdus luminescens subsp. laumondii TTO1	DNA polymerase V, subunit UmuC
CRON 2.
sulA	* Escherichia coli str. K-12 substr. MG1655 Site: position = -42 score = 5.58938 sequence = TACTGTACATCCATACAGTA Gene: b0958: Cell division inhibitor sulA	* Salmonella typhimurium LT2 Site: position = -41 score = 6.17771 sequence = TACTGTATGAATATACAGTA Gene: STM1071: Cell division inhibitor sulA	* Citrobacter koseri ATCC BAA-895 Site: position = -41 score = 6.02504 sequence = TACTGTATATCCATACAGTA Gene: CKO_02110: Cell division inhibitor sulA	* Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -39 score = 5.97269 sequence = TACTGTATATGCATACAGTA Gene: KPN_00987: Cell division inhibitor sulA	* Enterobacter sp. 638 Site: position = -34 score = 6.17771 sequence = TACTGTATATTCATACAGTA Gene: Ent638_1470: Cell division inhibitor sulA	* Erwinia amylovora ATCC 49946 Site: position = -40 score = 5.6787 sequence = TACTGTATATCCATACAGTC Gene: EAM_1378: Cell division inhibitor sulA	* Yersinia pestis KIM Site: position = -39 score = 6.05196 sequence = TACTGTATATACATACAGCA Gene: y2734: Cell division inhibitor sulA	* Serratia proteamaculans 568 Site: position = -41 score = 5.93191 sequence = TACTGTATAAACATACAGTG Gene: Spro_1755: Cell division inhibitor sulA	* Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -41 score = 6.06075 sequence = TACTGTATGTTCATACAGTA Gene: ECA1752: Cell division inhibitor sulA	* Edwardsiella tarda EIB202 Site: position = -115 score = 5.86477 sequence = TACTGTATAAGCATACAGTA Gene: ETAE_1269: Cell division inhibitor sulA	* Proteus mirabilis HI4320 Site: position = -39 score = 6.28564 sequence = TACTGTATATACATACAGTA Gene: PMI0786: Cell division inhibitor sulA	* Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -40 score = 5.9691 sequence = TACTGTATATTAATACAGTT Gene: plu1776: Cell division inhibitor sulA	Cell division inhibitor sulA
CRON 3.
uvrD	* Escherichia coli str. K-12 substr. MG1655 Site: position = -76 score = 4.88221 sequence = ATCTGTATATATACCCAGCT Gene: b3813: ATP-dependent DNA helicase II	* Salmonella typhimurium LT2 Site: position = -125 score = 4.76243 sequence = TTCTGTATAAATTCCCAGTT Gene: STM3951: ATP-dependent DNA helicase II	* Citrobacter koseri ATCC BAA-895 Site: position = -76 score = 5.0196 sequence = TATTGTATATATACCCAGCT Gene: CKO_00155: ATP-dependent DNA helicase II	* Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -53 score = 4.6323 sequence = CTCTGTATATATTAACAGGG Gene: KPN_04312: ATP-dependent DNA helicase II	* Enterobacter sp. 638 Site: position = -68 score = 5.1075 sequence = TATTGTATAAATCAACAGTA Gene: Ent638_3979: ATP-dependent DNA helicase II	* Erwinia amylovora ATCC 49946 Site: position = -55 score = 4.95805 sequence = ACCTGGTTATTTAACCAGTG Gene: EAM_0187: ATP-dependent DNA helicase II	* Yersinia pestis KIM Site: position = -82 score = 4.73719 sequence = CCCTGTGTAAATCTACAGTG Gene: y0389: ATP-dependent DNA helicase II	* Serratia proteamaculans 568 Site: position = -56 score = 4.39871 sequence = CTCTGTATAAATTCCCAGTG Gene: Spro_0186: ATP-dependent DNA helicase II	* Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -71 score = 4.51219 sequence = ATCTGTATAAATCACCAGTG Gene: ECA4179: ATP-dependent DNA helicase II	* Edwardsiella tarda EIB202 Site: position = -65 score = 5.03689 sequence = TTCTGTATAAATCTCCAGTA Gene: ETAE_0126: ATP-dependent DNA helicase II	* Proteus mirabilis HI4320 Site: position = -47 score = 5.05575 sequence = TTCTGTATATATCCACAGTA Gene: PMI3340: ATP-dependent DNA helicase II	* Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -55 score = 5.0445 sequence = TTCTGTATAAAAACACAGCA Gene: plu4636: ATP-dependent DNA helicase II	ATP-dependent DNA helicase II
CRON 4.
recA	* Escherichia coli str. K-12 substr. MG1655 Site: position = -79 score = 5.74781 sequence = TACTGTATGAGCATACAGTA Gene: b2699: Recombinase A	* Salmonella typhimurium LT2 Site: position = -84 score = 5.74781 sequence = TACTGTATGAGCATACAGTA Gene: STM2829: Recombinase A	* Citrobacter koseri ATCC BAA-895 Site: position = -96 score = 5.48145 sequence = TACTGTATGACTGTACAGTA Gene: CKO_04050: Recombinase A	* Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -90 score = 5.80015 sequence = TACTGTATGACCATACAGTA Gene: KPN_03031: Recombinase A	* Enterobacter sp. 638 Site: position = -92 score = 5.91711 sequence = TACTGTATGACTATACAGTA Gene: Ent638_3174: Recombinase A	* Erwinia amylovora ATCC 49946 Site: position = -88 score = 6.06979 sequence = TACTGTATGATTATACAGTA Gene: EAM_2640: Recombinase A	*2 Yersinia pestis KIM Gene: Y1113: Recombinase A Site: position = -102 score = 5.63413 sequence = TACTGTATGATTGTACAGTA Gene: y0881: Recombinase A	* Serratia proteamaculans 568 Site: position = -100 score = 5.80015 sequence = TACTGTATGACCATACAGTA Gene: Spro_0841: Recombinase A	* Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -101 score = 5.73902 sequence = TGCTGTATGTGTATACAGTA Gene: ECA3369: Recombinase A	* Edwardsiella tarda EIB202 Site: position = -63 score = 5.74781 sequence = TACTGTATGAGCATACAGTA Gene: ETAE_2861: Recombinase A	* Proteus mirabilis HI4320 Site: position = -102 score = 6.06979 sequence = TACTGTATGATTATACAGTA Gene: PMI0375: Recombinase A	* Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -100 score = 5.83612 sequence = TGCTGTATGATTATACAGTA Gene: plu1249: Recombinase A	Recombinase A
recX	Escherichia coli str. K-12 substr. MG1655 Gene: b2698: regulatory protein RecX	Salmonella typhimurium LT2 Gene: STM2828: regulatory protein RecX	Citrobacter koseri ATCC BAA-895 Gene: CKO_04049: regulatory protein RecX	Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Gene: KPN_03030: regulatory protein RecX	Enterobacter sp. 638 Gene: Ent638_3173: regulatory protein RecX	Erwinia amylovora ATCC 49946 Gene: EAM_2639: regulatory protein RecX	Yersinia pestis KIM Gene: y0882: regulatory protein RecX	Serratia proteamaculans 568 Gene: Spro_0842: regulatory protein RecX	Erwinia carotovora subsp. atroseptica SCRI1043 Gene: ECA3368: regulatory protein RecX	Edwardsiella tarda EIB202 Gene: ETAE_2860: regulatory protein RecX	Proteus mirabilis HI4320 Gene: PMI2663: regulatory protein RecX	Photorhabdus luminescens subsp. laumondii TTO1 Gene: plu3294: regulatory protein RecX	regulatory protein RecX
CRON 5.
dinB	* Escherichia coli str. K-12 substr. MG1655 Site: position = -34 score = 4.75357 sequence = CACTGTATACTTTACCAGTG Gene: b0231: DNA polymerase IV (EC 2.7.7.7)	* Salmonella typhimurium LT2 Site: position = -35 score = 5.39505 sequence = TACTGTACACTTAAACAGTA Gene: STM0313: DNA polymerase IV (EC 2.7.7.7)	* Citrobacter koseri ATCC BAA-895 Site: position = -35 score = 5.83071 sequence = TACTGTATACTTAAACAGTA Gene: CKO_02960: DNA polymerase IV (EC 2.7.7.7)	* Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = 1 score = 5.23262 sequence = TGCTGTATGGGTATACAGTG Gene: KPN_00247: DNA polymerase IV (EC 2.7.7.7)	* Enterobacter sp. 638 Site: position = -37 score = 5.7696 sequence = TACTGTATACTTATCCAGTA Gene: Ent638_0762: DNA polymerase IV (EC 2.7.7.7)	* Erwinia amylovora ATCC 49946 Site: position = -36 score = 5.42326 sequence = GACTGTATACTTATCCAGTA Gene: EAM_0894: DNA polymerase IV (EC 2.7.7.7)	* Yersinia pestis KIM Site: position = -41 score = 5.27383 sequence = GACTGTATACTTATACAGCT Gene: y0959: DNA polymerase IV (EC 2.7.7.7)	* Serratia proteamaculans 568 Site: position = -35 score = 5.71168 sequence = GCCTGTATATTTATACAGTA Gene: Spro_0962: DNA polymerase IV (EC 2.7.7.7)	* Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -36 score = 5.53221 sequence = ATCTGTATATTCATACAGTA Gene: ECA3468: DNA polymerase IV (EC 2.7.7.7)	* Edwardsiella tarda EIB202 Site: position = -42 score = 5.63109 sequence = TGCTGTATACTCATACAGTA Gene: ETAE_0788: DNA polymerase IV (EC 2.7.7.7)	* Proteus mirabilis HI4320 Site: position = -39 score = 6.14366 sequence = TACTGTATATTTAAACAGTA Gene: PMI0362: DNA polymerase IV (EC 2.7.7.7)	* Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -42 score = 4.84273 sequence = TTATGTATGTTTATACAGTT Gene: plu1239: DNA polymerase IV (EC 2.7.7.7)	DNA polymerase IV (EC 2.7.7.7)
CRON 6.
lexA	* Escherichia coli str. K-12 substr. MG1655 Site: position = -47 score = 5.14368 sequence = TGCTGTATATACTCACAGCA Site: position = -26 score = 5.16198 sequence = AACTGTATATACACCCAGGG Gene: b4043: LexA repressor	* Salmonella typhimurium LT2 Site: position = -47 score = 5.24946 sequence = AACTGTATATACTCACAGCA Site: position = -26 score = 4.4354 sequence = GATTGTATATACACCCAGGG Gene: STM4237: LexA repressor	* Citrobacter koseri ATCC BAA-895 Site: position = -47 score = 5.01579 sequence = AGCTGTATATACTCACAGCA Site: position = -26 score = 5.16198 sequence = AACTGTATATACACCCAGGG Gene: CKO_03872: LexA repressor	* Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -47 score = 5.01579 sequence = AGCTGTATATACTCACAGCA Site: position = -26 score = 5.16198 sequence = AACTGTATATACACCCAGGG Gene: KPN_04431: LexA repressor	* Enterobacter sp. 638 Site: position = -47 score = 5.03101 sequence = GACTGTATATACTCACAGCA Site: position = -26 score = 5.16198 sequence = AACTGTATATACACCCAGGG Gene: Ent638_0247: LexA repressor	* Erwinia amylovora ATCC 49946 Site: position = -46 score = 4.90015 sequence = ACCTGTATATACTCACAGTC Site: position = -26 score = 4.98578 sequence = GACTGTATAAACAACCAGGG Gene: EAM_0264: LexA repressor	* Yersinia pestis KIM Site: position = -47 score = 5.01579 sequence = AGCTGTATATACTCACAGCA Site: position = -26 score = 5.41636 sequence = AACTGTATAAACAAACAGGG Gene: y0572: LexA repressor	* Serratia proteamaculans 568 Site: position = -47 score = 5.01281 sequence = ACCTGTATATACTCACAGCA Site: position = -26 score = 5.19791 sequence = GACTGTATAAACAAACAGGG Gene: Spro_4460: LexA repressor	* Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -47 score = 5.01281 sequence = ACCTGTATATACTCACAGCA Site: position = -26 score = 4.98578 sequence = GACTGTATAAACAACCAGGG Gene: ECA0630: LexA repressor	* Edwardsiella tarda EIB202 Site: position = -47 score = 5.01281 sequence = ACCTGTATATACTCACAGCA Site: position = -26 score = 4.9807 sequence = AACTGTATAAACGAACAGGG Gene: ETAE_0230: LexA repressor	* Proteus mirabilis HI4320 Site: position = -47 score = 4.90015 sequence = ACCTGTATATACTCACAGTC Site: position = -26 score = 5.19791 sequence = GACTGTATAAACAAACAGGG Gene: PMI2749: LexA repressor	* Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -26 score = 5.19791 sequence = GACTGTATAAACAAACAGGG Gene: plu4374: LexA repressor	SOS-response repressor and protease LexA (EC 3.4.21.88)
dinF	Escherichia coli str. K-12 substr. MG1655 Gene: b4044: DNA-damage-inducible SOS response protein	Salmonella typhimurium LT2 Gene: STM4238: DNA-damage-inducible SOS response protein	Citrobacter koseri ATCC BAA-895 Gene: CKO_03870: DNA-damage-inducible SOS response protein	Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Gene: KPN_04432: DNA-damage-inducible SOS response protein	Enterobacter sp. 638 Gene: Ent638_0248: DNA-damage-inducible SOS response protein	Erwinia amylovora ATCC 49946 Gene: EAM_0265: DNA-damage-inducible SOS response protein	Yersinia pestis KIM	Serratia proteamaculans 568 Gene: Spro_4459: DNA-damage-inducible SOS response protein	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202 Gene: ETAE_0231: DNA-damage-inducible SOS response protein	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	DNA-damage-inducible SOS response protein
CRON 7.
ftsK	* Escherichia coli str. K-12 substr. MG1655 Site: position = -96 score = 5.03028 sequence = TCCTGTTAATCCATACAGCA Gene: b0890: DNA translocase FtsK	* Salmonella typhimurium LT2 Site: position = -96 score = 5.03028 sequence = TCCTGTTAATCCATACAGCA Gene: STM0960: DNA translocase FtsK	* Citrobacter koseri ATCC BAA-895 Site: position = -39 score = 5.03028 sequence = TCCTGTTAATCCATACAGCA Gene: CKO_02181: DNA translocase FtsK	* Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -97 score = 5.03028 sequence = TCCTGTTAATCCATACAGCA Gene: KPN_00922: DNA translocase FtsK	* Enterobacter sp. 638 Site: position = -96 score = 5.03028 sequence = TCCTGTTAATCCATACAGCA Gene: Ent638_1414: DNA translocase FtsK	* Erwinia amylovora ATCC 49946 Site: position = -80 score = 4.90191 sequence = TCCTGTGAATTCATACAGGT Gene: EAM_1329: DNA translocase FtsK	* Yersinia pestis KIM Site: position = -86 score = 5.66216 sequence = TCCTGTTTATTCATACAGTT Gene: y2800: DNA translocase FtsK	* Serratia proteamaculans 568 Site: position = -85 score = 5.66216 sequence = TCCTGTTTATTCATACAGTT Gene: Spro_1683: DNA translocase FtsK	* Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -78 score = 5.03707 sequence = TCCTGTGAATTTATACAGTC Gene: ECA2647: DNA translocase FtsK	* Edwardsiella tarda EIB202 Site: position = -114 score = 5.42392 sequence = TCCTGTGTATGTATACAGTT Gene: ETAE_2199: DNA translocase FtsK	* Proteus mirabilis HI4320 Site: position = -83 score = 5.5741 sequence = TCCTGTTTATGTATACAGTT Gene: PMI0697: DNA translocase FtsK	* Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -81 score = 5.45714 sequence = TCCTGTTTATGCATACAGTT Gene: plu1601: DNA translocase FtsK	DNA translocase FtsK
CRON 8.
ydjM	* Escherichia coli str. K-12 substr. MG1655 Site: position = -52 score = 4.43806 sequence = CACTGTATAAAAATCCTATA Site: position = -34 score = 4.6848 sequence = TACTGTACGTATCGACAGTT Gene: b1728: membrane-bound metal-dependent hydrolase	* Salmonella typhimurium LT2 Site: position = -52 score = 4.38267 sequence = TACTGTATAAAAACCCTATA Site: position = -34 score = 5.16715 sequence = TACTGTATGAATTGACAGTT Gene: STM1321: membrane-bound metal-dependent hydrolase	* Citrobacter koseri ATCC BAA-895 Site: position = -52 score = 4.38267 sequence = TACTGTATAAAAACCCTATA Site: position = -34 score = 5.16715 sequence = TACTGTATGAATTGACAGTT Gene: CKO_01754: membrane-bound metal-dependent hydrolase	* Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -34 score = 5.01253 sequence = TACTGTATGAATCGACAGTT Gene: KPN_01239: membrane-bound metal-dependent hydrolase	* Enterobacter sp. 638 Site: position = -34 score = 5.16715 sequence = TACTGTATGAATTGACAGTT Gene: Ent638_1715: membrane-bound metal-dependent hydrolase	* Erwinia amylovora ATCC 49946 Site: position = -56 score = 4.31486 sequence = TACTGTATATATTCCCTATA Site: position = -38 score = 4.75 sequence = TACTGGATGCATTGACAGTT Gene: EAM_1619: membrane-bound metal-dependent hydrolase	* Yersinia pestis KIM Site: position = -39 score = 5.04193 sequence = TACTGGATAAATCAACAGCT Gene: y1879: membrane-bound metal-dependent hydrolase	* Serratia proteamaculans 568 Site: position = -39 score = 5.43022 sequence = TACTGGATAAATTAACAGTT Gene: Spro_2124: membrane-bound metal-dependent hydrolase	* Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -36 score = 5.44466 sequence = TACTGTATAAAATAACAGTT Gene: ECA2409: membrane-bound metal-dependent hydrolase	* Edwardsiella tarda EIB202 Site: position = -109 score = 5.54338 sequence = TTCTGTATATTTATACAGCA Gene: ETAE_1569: membrane-bound metal-dependent hydrolase	* Proteus mirabilis HI4320 Site: position = -54 score = 5.22853 sequence = CACTGTATAAATGAACAGCA Gene: PMI1020: membrane-bound metal-dependent hydrolase	* Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -37 score = 5.04156 sequence = GACTGTATGGATAGACAGTT Gene: plu2679: membrane-bound metal-dependent hydrolase	membrane-bound metal-dependent hydrolase
CRON 9.
recN	* Escherichia coli str. K-12 substr. MG1655 Site: position = -68 score = 5.71388 sequence = TACTGTATATAAAACCAGTT Site: position = -46 score = 4.93187 sequence = TACTGTACACAATAACAGTA Site: position = -28 score = 4.69075 sequence = TAATGGTTTTTCATACAGGA Gene: b2616: DNA repair protein RecN	* Salmonella typhimurium LT2 Site: position = -68 score = 5.60596 sequence = TACTGTATAAAAAACCAGTT Site: position = -46 score = 5.28746 sequence = TACTGTATTTAATTACAGTC Site: position = -28 score = 4.4541 sequence = TCATGGTTTTTCATACAGGA Gene: STM2684: DNA repair protein RecN	* Citrobacter koseri ATCC BAA-895 Site: position = -68 score = 5.60596 sequence = TACTGTATAAAAAACCAGTT Site: position = -46 score = 5.067 sequence = TACTGTATGTAATCACAGTC Site: position = -28 score = 4.4541 sequence = TCATGGTTTTTCATACAGGA Gene: CKO_03938: DNA repair protein RecN	* Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -68 score = 5.17538 sequence = TACTGGATAAAAAACCAGTC Site: position = -46 score = 5.24317 sequence = TACTGTACGAAAACACAGTA Site: position = -28 score = 4.87211 sequence = TATTGGTTTTTCATACAGGA Gene: KPN_02938: DNA repair protein RecN	* Enterobacter sp. 638 Site: position = -68 score = 5.60596 sequence = TACTGTATAAAAAACCAGTT Site: position = -46 score = 5.81642 sequence = TACTGTATAGAAATACAGTT Gene: Ent638_3096: DNA repair protein RecN	* Erwinia amylovora ATCC 49946 Site: position = -68 score = 5.69075 sequence = TACTGTTTATAAAACCAGTA Site: position = -46 score = 4.2819 sequence = TACTGTATGAAAAACCATAT Site: position = -28 score = 4.79668 sequence = ATCTGTGTTTTCATACAGGA Gene: EAM_2529: DNA repair protein RecN	* Yersinia pestis KIM Site: position = 39 score = 5.49543 sequence = TACTGTATATAAAACCAGTC Site: position = 61 score = 4.52913 sequence = TACTGTGTTCAAATACAGAC Gene: y3075: DNA repair protein RecN	* Serratia proteamaculans 568 Site: position = -68 score = 5.49543 sequence = TACTGTATATAAAACCAGTC Site: position = -46 score = 5.02291 sequence = TACTGTATGAAACCACAGTT Site: position = -28 score = 4.45997 sequence = TTATGTATTTATACACAGGA Gene: Spro_3686: DNA repair protein RecN	* Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -61 score = 5.71388 sequence = TACTGTATATAAAACCAGTT Site: position = -39 score = 5.44042 sequence = TACTGTATGTAAACACAGTC Gene: ECA0840: DNA repair protein RecN	* Edwardsiella tarda EIB202 Site: position = -68 score = 5.60596 sequence = TACTGTATAAAAAACCAGTT Site: position = -46 score = 4.61122 sequence = TACTGGCATTAAACACAGTA Gene: ETAE_2737: DNA repair protein RecN	* Proteus mirabilis HI4320 Site: position = -66 score = 5.60596 sequence = TACTGTATAAAAAACCAGTT Site: position = -44 score = 5.06902 sequence = TACTGTATGTAATTACAGAT Gene: PMI1902: DNA repair protein RecN	* Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -68 score = 5.60596 sequence = TACTGTATAAAAAACCAGTT Site: position = -46 score = 4.83985 sequence = TACTGTATGAAGATACAGAG Site: position = -28 score = 4.50938 sequence = AGGTGTTTTTATACACAGGA Gene: plu3374: DNA repair protein RecN	DNA repair protein RecN
CRON 10.
uvrB	* Escherichia coli str. K-12 substr. MG1655 Site: position = -94 score = 5.60596 sequence = AACTGTTTTTTTATCCAGTA Gene: b0779: Excinuclease ABC subunit B	* Salmonella typhimurium LT2 Site: position = -93 score = 5.61688 sequence = TACTGTTTTTTCATCCAGTA Gene: STM0798: Excinuclease ABC subunit B	* Citrobacter koseri ATCC BAA-895 Site: position = -93 score = 5.37108 sequence = CACTGTTTTTTCATCCAGTA Gene: CKO_02348: Excinuclease ABC subunit B	* Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -95 score = 5.68573 sequence = CACTGTTTAAATATCCAGTA Gene: KPN_00804: Excinuclease ABC subunit B	* Enterobacter sp. 638 Site: position = -95 score = 5.41789 sequence = CACTGGATTTACATCCAGTA Gene: Ent638_1271: Excinuclease ABC subunit B	* Erwinia amylovora ATCC 49946 Site: position = -96 score = 4.71081 sequence = AGCTGTGATTATATCCAGTG Gene: EAM_1216: Excinuclease ABC subunit B	* Yersinia pestis KIM Site: position = -97 score = 5.26808 sequence = AGCTGGTTTTATATCCAGTA Gene: y3026: Excinuclease ABC subunit B	* Serratia proteamaculans 568 Site: position = -130 score = 5.26808 sequence = AGCTGGTTTTATATCCAGTA Gene: Spro_1317: Excinuclease ABC subunit B	* Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -232 score = 5.60809 sequence = TgCTGTtTtTATATcCAGTA Gene: ECA2820: Excinuclease ABC subunit B	* Edwardsiella tarda EIB202 Site: position = -106 score = 5.20766 sequence = AGCTGGGTAAATATCCAGTA Gene: ETAE_2547: Excinuclease ABC subunit B	* Proteus mirabilis HI4320 Site: position = -51 score = 5.31117 sequence = AGCTGGATTTTTATCCAGTA Gene: PMI0607: Excinuclease ABC subunit B	* Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -56 score = 5.26808 sequence = AGCTGGTTTTATATCCAGTA Gene: plu1491: Excinuclease ABC subunit B	Excinuclease ABC subunit B
CRON 11.
ruvA	* Escherichia coli str. K-12 substr. MG1655 Site: position = -69 score = 5.0046 sequence = CGCTGGATATCTATCCAGCA Gene: b1861: Holliday junction helicase subunit A	* Salmonella typhimurium LT2 Site: position = -71 score = 4.76161 sequence = ATCTGGATAAACATCCAGTC Gene: STM1895: Holliday junction helicase subunit A	* Citrobacter koseri ATCC BAA-895 Site: position = -70 score = 4.55772 sequence = GGCTGGATATCTATCCAGCC Gene: CKO_01099: Holliday junction helicase subunit A	* Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -69 score = 4.55772 sequence = GGCTGGATATCTATCCAGCC Gene: KPN_02376: Holliday junction helicase subunit A	* Enterobacter sp. 638 Site: position = -69 score = 4.59343 sequence = GGCTGGATAAACATCCAGCC Gene: Ent638_2430: Holliday junction helicase subunit A	* Erwinia amylovora ATCC 49946 Site: position = -68 score = 4.99462 sequence = AGCTGGATATCTATCCAGCT Gene: EAM_2004: Holliday junction helicase subunit A	* Yersinia pestis KIM Site: position = -244 score = 4.44076 sequence = GGCTGGATATCCATCCAGCC Gene: y2253: Holliday junction helicase subunit A	* Serratia proteamaculans 568 Site: position = -91 score = 4.59343 sequence = GGCTGGATATTCATCCAGCC Gene: Spro_2777: Holliday junction helicase subunit A	* Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -84 score = 4.93977 sequence = TGCTGGATATTCATCCAGCC Gene: ECA2492: Holliday junction helicase subunit A	* Edwardsiella tarda EIB202 Site: position = -74 score = 4.59343 sequence = GGCTGGATATTCATCCAGCC Gene: ETAE_1439: Holliday junction helicase subunit A	* Proteus mirabilis HI4320 Site: position = -68 score = 4.48415 sequence = GGCTGGATATACGTCCAGCT Gene: PMI1115: Holliday junction helicase subunit A	* Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -85 score = 4.60686 sequence = GGCTGGATATGCATCCAGCT Gene: plu2111: Holliday junction helicase subunit A	Holliday junction helicase subunit A
ruvB	Escherichia coli str. K-12 substr. MG1655 Gene: b1860: Holliday junction DNA helicase B	Salmonella typhimurium LT2 Gene: STM1894: Holliday junction DNA helicase B	Citrobacter koseri ATCC BAA-895 Gene: CKO_01101: Holliday junction DNA helicase B	Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Gene: KPN_02375: Holliday junction DNA helicase B	Enterobacter sp. 638 Gene: Ent638_2429: Holliday junction DNA helicase B	Erwinia amylovora ATCC 49946 Gene: EAM_2003: Holliday junction DNA helicase B	Yersinia pestis KIM Gene: y2252: Holliday junction DNA helicase B	Serratia proteamaculans 568 Gene: Spro_2776: Holliday junction DNA helicase B	Erwinia carotovora subsp. atroseptica SCRI1043 Gene: ECA2491: Holliday junction DNA helicase B	Edwardsiella tarda EIB202 Gene: ETAE_1440: Holliday junction DNA helicase B	Proteus mirabilis HI4320 Gene: PMI1116: Holliday junction DNA helicase B	Photorhabdus luminescens subsp. laumondii TTO1 Gene: plu2112: Holliday junction DNA helicase B	Holliday junction DNA helicase B
CRON 12.
yebG	* Escherichia coli str. K-12 substr. MG1655 Site: position = -37 score = 5.29448 sequence = TACTGTATAAAATCACAGTT Gene: b1848: SOS regulon DNA damage-inducible protein	* Salmonella typhimurium LT2 Site: position = -37 score = 5.53918 sequence = TACTGTATATAAACACAGGT Gene: STM1882: SOS regulon DNA damage-inducible protein	* Citrobacter koseri ATCC BAA-895 Site: position = -38 score = 4.79762 sequence = TGCTGTACATAATTACAGGT Gene: CKO_01118: SOS regulon DNA damage-inducible protein	* Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -35 score = 5.85118 sequence = TACTGTATAAAAATACAGTG Gene: KPN_02363: SOS regulon DNA damage-inducible protein	* Enterobacter sp. 638 Site: position = -33 score = 5.33989 sequence = CACTGTATATAATTACAGTG Gene: Ent638_1887: SOS regulon DNA damage-inducible protein	* Erwinia amylovora ATCC 49946 Site: position = -35 score = 5.6679 sequence = TACTGTATAAAAACACAGTT Gene: EAM_1993: SOS regulon DNA damage-inducible protein	* Yersinia pestis KIM Site: position = -47 score = 5.15661 sequence = CACTGTGATTATATACAGTT Gene: y2530: SOS regulon DNA damage-inducible protein	* Serratia proteamaculans 568 Site: position = -44 score = 6.09698 sequence = TACTGTATAAAAATACAGTA Gene: Spro_2803: SOS regulon DNA damage-inducible protein	Erwinia carotovora subsp. atroseptica SCRI1043	* Edwardsiella tarda EIB202 Site: position = -31 score = 5.8081 sequence = TACTGTATATAAAAACAGTG Gene: ETAE_1833: SOS regulon DNA damage-inducible protein	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	SOS regulon DNA damage-inducible protein
CRON 13.
dinG	* Escherichia coli str. K-12 substr. MG1655 Site: position = -34 score = 4.94821 sequence = TATTGGCTGTTTATACAGTA Gene: b0799: ATP-dependent helicase DinG/Rad3	* Salmonella typhimurium LT2 Site: position = -34 score = 4.81122 sequence = TAGTGGCTGTTTATACAGTA Gene: STM0821: ATP-dependent helicase DinG/Rad3	* Citrobacter koseri ATCC BAA-895 Site: position = -34 score = 4.81122 sequence = TAGTGGCTGTTTATACAGTA Gene: CKO_02329: ATP-dependent helicase DinG/Rad3	* Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -33 score = 4.81122 sequence = TAGTGGCTGTTTATACAGTA Gene: KPN_00831: ATP-dependent helicase DinG/Rad3	* Enterobacter sp. 638 Site: position = -34 score = 4.81122 sequence = TAGTGGCTGTTTATACAGTA Gene: Ent638_1289: ATP-dependent helicase DinG/Rad3	* Erwinia amylovora ATCC 49946 Site: position = -43 score = 4.78012 sequence = TACTGTGCAAAAATACAGCC Gene: EAM_1250: ATP-dependent helicase DinG/Rad3	Yersinia pestis KIM Gene: y2982: ATP-dependent helicase DinG/Rad3	Serratia proteamaculans 568 Gene: Spro_1461: ATP-dependent helicase DinG/Rad3	Erwinia carotovora subsp. atroseptica SCRI1043 Gene: ECA2786: ATP-dependent helicase DinG/Rad3	Edwardsiella tarda EIB202 Gene: ETAE_1175: ATP-dependent helicase DinG/Rad3	Proteus mirabilis HI4320 Gene: PMI0630: ATP-dependent helicase DinG/Rad3	Photorhabdus luminescens subsp. laumondii TTO1 Gene: plu1524: ATP-dependent helicase DinG/Rad3	ATP-dependent helicase DinG/Rad3
CRON 14.
polB	* Escherichia coli str. K-12 substr. MG1655 Site: position = -73 score = 4.3414 sequence = GACTGTATAAAACCACAGCC Gene: b0060: DNA polymerase II (EC 2.7.7.7)	* Salmonella typhimurium LT2 Site: position = -73 score = 4.5539 sequence = gcCTGTAcAaAataACAGTA Gene: STM0097: DNA polymerase II (EC 2.7.7.7)	* Citrobacter koseri ATCC BAA-895 Site: position = -73 score = 4.66954 sequence = ACCTGTATAAAACCACAGCA Gene: CKO_03322: DNA polymerase II (EC 2.7.7.7)	* Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -75 score = 4.21162 sequence = ACCTGTATAAAACCCCAGCG Gene: KPN_00059: DNA polymerase II (EC 2.7.7.7)	* Enterobacter sp. 638 Site: position = 30 score = 4.61203 sequence = ACCTGTATAAAATCCCAGCA Gene: Ent638_0607: DNA polymerase II (EC 2.7.7.7)	* Erwinia amylovora ATCC 49946 Site: position = -53 score = 4.87119 sequence = TACTGTATAAATAAACATGC Gene: EAM_0673: DNA polymerase II (EC 2.7.7.7)	Yersinia pestis KIM Gene: y3655: DNA polymerase II (EC 2.7.7.7)	Serratia proteamaculans 568 Gene: Spro_0731: DNA polymerase II (EC 2.7.7.7)	Erwinia carotovora subsp. atroseptica SCRI1043 Gene: ECA3852: DNA polymerase II (EC 2.7.7.7)	Edwardsiella tarda EIB202 Gene: ETAE_0607: DNA polymerase II (EC 2.7.7.7)	Proteus mirabilis HI4320 Gene: PMI2327: DNA polymerase II (EC 2.7.7.7)	Photorhabdus luminescens subsp. laumondii TTO1	DNA polymerase II (EC 2.7.7.7)
CRON 15.
cho	* Escherichia coli str. K-12 substr. MG1655 Site: position = -33 score = 5.08726 sequence = CACTGGATAGATAACCAGCA Gene: b1741: endonuclease of nucleotide excision repair	* Salmonella typhimurium LT2 Site: position = -6 score = 5.47456 sequence = TACTGGATGAATAACCAGTT Gene: STM1309: endonuclease of nucleotide excision repair	Citrobacter koseri ATCC BAA-895	* Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -32 score = 5.30365 sequence = TACTGGATGGATAGACAGTA Gene: KPN_01227: endonuclease of nucleotide excision repair	* Enterobacter sp. 638 Site: position = -33 score = 5.04893 sequence = CACTGTATAGCTGAACAGTA Gene: Ent638_1703: endonuclease of nucleotide excision repair	* Erwinia amylovora ATCC 49946 Site: position = -33 score = 5.28735 sequence = TACTGTTCGGATAAACAGTA Gene: EAM_1613: endonuclease of nucleotide excision repair	Yersinia pestis KIM	Serratia proteamaculans 568	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	endonuclease of nucleotide excision repair
CRON 16.
tag	Escherichia coli str. K-12 substr. MG1655 Gene: b3549: DNA-3-methyladenine glycosylase I	Salmonella typhimurium LT2 Gene: STM3642: DNA-3-methyladenine glycosylase I	Citrobacter koseri ATCC BAA-895 Gene: CKO_04999: DNA-3-methyladenine glycosylase I	Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Gene: KPN_03907: DNA-3-methyladenine glycosylase I	Enterobacter sp. 638 Gene: Ent638_0175: DNA-3-methyladenine glycosylase I	Erwinia amylovora ATCC 49946 Gene: EAM_3433: DNA-3-methyladenine glycosylase I	Yersinia pestis KIM Gene: y4091: DNA-3-methyladenine glycosylase I	* Serratia proteamaculans 568 Site: position = -34 score = 5.29662 sequence = TACTGTAAATAAACACAGCA Gene: Spro_0064: DNA-3-methyladenine glycosylase I	* Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -115 score = 4.89641 sequence = CGCTGGTTGCATATACAGCA Gene: ECA0082: DNA-3-methyladenine glycosylase I	Edwardsiella tarda EIB202 Gene: ETAE_0014: DNA-3-methyladenine glycosylase I	* Proteus mirabilis HI4320 Site: position = -78 score = 4.74178 sequence = ACATGTGTTTTTATACAGTA Gene: PMI2853: DNA-3-methyladenine glycosylase I	* Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -65 score = 5.14145 sequence = ACTTGTATATCTATACAGTT Gene: plu0292: DNA-3-methyladenine glycosylase I	DNA-3-methyladenine glycosylase I
CRON 17.
mug	* Escherichia coli str. K-12 substr. MG1655 Site: position = -69 score = 4.91529 sequence = TGCTGTTTTTATAAACAATG Gene: b3068: DNA glycosylase, G/U mismatch specific	* Salmonella typhimurium LT2 Site: position = -70 score = 4.91529 sequence = TGCTGTTTTTATAAACAATG Gene: STM3212: DNA glycosylase, G/U mismatch specific	* Citrobacter koseri ATCC BAA-895 Site: position = -70 score = 4.68162 sequence = TGCTGTTTTTATAAACAACG Gene: CKO_04467: DNA glycosylase, G/U mismatch specific	* Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -69 score = 4.91529 sequence = TGCTGTTTTTATAAACAATG Gene: KPN_03475: DNA glycosylase, G/U mismatch specific	* Enterobacter sp. 638 Site: position = -70 score = 4.91529 sequence = TGCTGTTTTTATAAACAATG Gene: Ent638_3474: DNA glycosylase, G/U mismatch specific	Erwinia amylovora ATCC 49946 Gene: EAM_3006: DNA glycosylase, G/U mismatch specific	Yersinia pestis KIM	Serratia proteamaculans 568 Gene: Spro_4301: DNA glycosylase, G/U mismatch specific	Erwinia carotovora subsp. atroseptica SCRI1043 Gene: ECA0679: DNA glycosylase, G/U mismatch specific	Edwardsiella tarda EIB202 Gene: ETAE_0453: DNA glycosylase, G/U mismatch specific	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	DNA glycosylase, G/U mismatch specific
CRON 18.
uvrA	* Escherichia coli str. K-12 substr. MG1655 Site: position = -103 score = 5.45345 sequence = TACTGTATATTCATTCAGGT Gene: b4058: excinuclease ABC subunit A	* Salmonella typhimurium LT2 Site: position = -100 score = 5.66216 sequence = TACTGTATATTCAAACAGGT Gene: STM4254: excinuclease ABC subunit A	* Citrobacter koseri ATCC BAA-895 Site: position = -102 score = 5.30078 sequence = TACTGTATATCCATTCAGGT Gene: CKO_03843: excinuclease ABC subunit A	* Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -105 score = 5.45345 sequence = TACTGTATATTCATTCAGGT Gene: KPN_04445: excinuclease ABC subunit A	* Enterobacter sp. 638 Site: position = -100 score = 5.66216 sequence = TACTGTATATTCAAACAGGT Gene: Ent638_0261: excinuclease ABC subunit A	* Erwinia amylovora ATCC 49946 Site: position = -101 score = 4.47338 sequence = CACTGGTTATCCATTCAGGC Gene: EAM_0307: excinuclease ABC subunit A	* Yersinia pestis KIM Site: position = -318 score = 4.84285 sequence = CACTGGATATCCATTCAGGT Gene: y0580: excinuclease ABC subunit A	* Serratia proteamaculans 568 Site: position = -140 score = 5.24132 sequence = TACTGGATATTCATTCAGGT Gene: Spro_4440: excinuclease ABC subunit A	* Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -107 score = 5.47797 sequence = TACTGGATATTCATTCAGTT Gene: ECA3689: excinuclease ABC subunit A	* Edwardsiella tarda EIB202 Site: position = -92 score = 5.3253 sequence = TACTGGATATCCATTCAGTT Gene: ETAE_3184: excinuclease ABC subunit A	* Proteus mirabilis HI4320 Site: position = -84 score = 5.30376 sequence = TACTGTATATCCATTCAGCT Gene: PMI2746: excinuclease ABC subunit A	* Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -209 score = 5.28492 sequence = TACTGTATATCTAATCAGTC Gene: plu4350: excinuclease ABC subunit A	excinuclease ABC subunit A
CRON 19.
dinI	* Escherichia coli str. K-12 substr. MG1655 Site: position = -39 score = 5.56699 sequence = ACCTGTATAAATAACCAGTA Gene: b1061: DNA damage-inducible protein	*4 Salmonella typhimurium LT2 Site: position = -39 score = 6.06258 sequence = AACTGTATATATATCCAGTA Gene: STM1162: DNA damage-inducible protein Site: position = -35 score = 6.00674 sequence = TACTGTATATACAAACAGTT Gene: STM1056: DNA damage-inducible protein Site: position = -39 score = 5.65792 sequence = TACTGTGTTTATATACAGTG Gene: STM2621: DNA damage-inducible protein Site: position = -39 score = 5.65792 sequence = TACTGTGTTTATATACAGTG Gene: STM1019: DNA damage-inducible protein	*2 Citrobacter koseri ATCC BAA-895 Site: position = -39 score = 5.86559 sequence = AACTGTATAAATACACAGTA Gene: CKO_02002: DNA damage-inducible protein Site: position = -25 score = 6.09698 sequence = TACTGTATAaAaATACAGTA Gene: CKO_01890: DNA damage-inducible protein	* Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -39 score = 5.93153 sequence = TACTGTATAAATAACCAGTA Gene: KPN_01073: DNA damage-inducible protein	*3 Enterobacter sp. 638 Site: position = -39 score = 5.79732 sequence = GACTGTATAAATAAACAGTA Gene: Ent638_1575: DNA damage-inducible protein Site: position = -32 score = 5.69234 sequence = TGCTGTATATAAAAACAGTT Gene: Ent638_1656: DNA damage-inducible protein Site: position = -38 score = 5.48533 sequence = CACTGTATAAATGTACAGTT Gene: Ent638_2256: DNA damage-inducible protein	* Erwinia amylovora ATCC 49946 Site: position = -38 score = 5.7734 sequence = AACTGTATATATTTACAGTT Gene: EAM_1429: DNA damage-inducible protein	* Yersinia pestis KIM Site: position = -41 score = 6.14366 sequence = TACTGTATAAATAAACAGTA Gene: y1747: DNA damage-inducible protein	* Serratia proteamaculans 568 Site: position = -39 score = 5.95466 sequence = AACTGTATAAATATCCAGTA Gene: Spro_1895: DNA damage-inducible protein	* Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -38 score = 5.88789 sequence = AACTGTATAAATAAACAGTT Gene: ECA1786: DNA damage-inducible protein	* Edwardsiella tarda EIB202 Site: position = -42 score = 5.66762 sequence = AGCTGTATATATTTACAGTA Gene: ETAE_2072: DNA damage-inducible protein	* Proteus mirabilis HI4320 Site: position = -45 score = 6.07702 sequence = TACTGTATTTATATACAGTT Gene: PMI1958: DNA damage-inducible protein	* Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -65 score = 5.66491 sequence = TACTGTTTATATGAACAGTA Gene: plu1815: DNA damage-inducible protein	DNA damage-inducible protein
CRON 20.
tisB	* Escherichia coli str. K-12 substr. MG1655 Site: position = -254 score = 6.14366 sequence = TACTGTTTATTTATACAGTA Gene: b4618: lexA-regulated toxic peptide	Salmonella typhimurium LT2	Citrobacter koseri ATCC BAA-895	Klebsiella pneumoniae subsp. pneumoniae MGH 78578	Enterobacter sp. 638	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	lexA-regulated toxic peptide
CRON 21.
sbmC	* Escherichia coli str. K-12 substr. MG1655 Site: position = -34 score = 6.0539 sequence = TACTGTATATAAAAACAGTA Gene: b2009: DNA gyrase inhibitor	* Salmonella typhimurium LT2 Site: position = -41 score = 5.50838 sequence = TACTGTACATTCATACAGCA Gene: STM2061: DNA gyrase inhibitor	* Citrobacter koseri ATCC BAA-895 Site: position = -157 score = 5.67004 sequence = TGCTGTGTTTATATACAGTA Gene: CKO_00775: DNA gyrase inhibitor	* Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -42 score = 5.81615 sequence = AGCTGTATATTCATACAGTA Gene: KPN_02467: DNA gyrase inhibitor	* Enterobacter sp. 638 Site: position = -35 score = 5.34837 sequence = TAGTGTATAAATACACAGTA Gene: Ent638_2577: DNA gyrase inhibitor	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568 Gene: Spro_3021: DNA gyrase inhibitor	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202 Gene: ETAE_1076: DNA gyrase inhibitor	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	DNA gyrase inhibitor
CRON 22.
dinD	* Escherichia coli str. K-12 substr. MG1655 Site: position = -63 score = 5.94914 sequence = AACTGTATATAAATACAGTT Gene: b3645: DNA-damage-inducible protein	Salmonella typhimurium LT2	Citrobacter koseri ATCC BAA-895	Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Gene: KPN_04089: DNA-damage-inducible protein	Enterobacter sp. 638	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	DNA-damage-inducible protein
CRON 23.
dinQ	* Escherichia coli str. K-12 substr. MG1655 Site: position = -188 score = 4.31841 sequence = TGCTGGTTTTATAACCTGCA Site: position = -166 score = 5.72977 sequence = TACTGTATGATTATCCAGTT Gene: b4613: Damage inducible, function unknown	Salmonella typhimurium LT2	Citrobacter koseri ATCC BAA-895	Klebsiella pneumoniae subsp. pneumoniae MGH 78578	Enterobacter sp. 638	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	Damage inducible, function unknown
CRON 24.
impA	Escherichia coli str. K-12 substr. MG1655	Salmonella typhimurium LT2	Citrobacter koseri ATCC BAA-895	* Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -44 score = 5.60955 sequence = TACTGTATGCATAACCAGTA Gene: KPN_pKPN5p08226: ImpA-like protein; UV protection	Enterobacter sp. 638	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	ImpA-like protein; UV protection
KPN_pKPN5p08225	Escherichia coli str. K-12 substr. MG1655	Salmonella typhimurium LT2	Citrobacter koseri ATCC BAA-895	Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Gene: KPN_pKPN5p08225: mutagenesis by UV and mutagens	Enterobacter sp. 638	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	mutagenesis by UV and mutagens
CRON 25.
PMI3143	Escherichia coli str. K-12 substr. MG1655	Salmonella typhimurium LT2	Citrobacter koseri ATCC BAA-895	Klebsiella pneumoniae subsp. pneumoniae MGH 78578	Enterobacter sp. 638	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202	* Proteus mirabilis HI4320 Site: position = -25 score = 5.56147 sequence = AACTGTTTTTATATACAGGT Gene: PMI3143: DNA modification methyltransferase	Photorhabdus luminescens subsp. laumondii TTO1	DNA modification methyltransferase
PMI3142	Escherichia coli str. K-12 substr. MG1655	Salmonella typhimurium LT2	Citrobacter koseri ATCC BAA-895	Klebsiella pneumoniae subsp. pneumoniae MGH 78578	Enterobacter sp. 638	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202	Proteus mirabilis HI4320 Gene: PMI3142: DNA modification methyltransferase	Photorhabdus luminescens subsp. laumondii TTO1	DNA modification methyltransferase
PMI3141	Escherichia coli str. K-12 substr. MG1655	Salmonella typhimurium LT2	Citrobacter koseri ATCC BAA-895	Klebsiella pneumoniae subsp. pneumoniae MGH 78578	Enterobacter sp. 638	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202	Proteus mirabilis HI4320 Gene: PMI3141: restriction endonuclease	Photorhabdus luminescens subsp. laumondii TTO1	restriction endonuclease
CRON 26.
ssb	* Escherichia coli str. K-12 substr. MG1655 Site: position = -170 score = 5.45345 sequence = ACCTGAATGAATATACAGTA Gene: b4059: single-strand binding protein	* Salmonella typhimurium LT2 Site: position = -167 score = 5.66216 sequence = ACCTGTTTGAATATACAGTA Gene: STM4256: single-strand binding protein	* Citrobacter koseri ATCC BAA-895 Site: position = -168 score = 5.30078 sequence = ACCTGAATGGATATACAGTA Gene: CKO_03842: single-strand binding protein	* Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -166 score = 5.45345 sequence = ACCTGAATGAATATACAGTA Gene: KPN_04446: single-strand binding protein	* Enterobacter sp. 638 Site: position = -165 score = 5.66216 sequence = ACCTGTTTGAATATACAGTA Gene: Ent638_0262: single-strand binding protein	* Erwinia amylovora ATCC 49946 Site: position = -171 score = 4.47338 sequence = GCCTGAATGGATAACCAGTG Gene: EAM_0308: single-strand binding protein	* Yersinia pestis KIM Site: position = -158 score = 4.84285 sequence = ACCTGAATGGATATCCAGTG Gene: y0582: single-strand binding protein	* Serratia proteamaculans 568 Site: position = -157 score = 5.24132 sequence = ACCTGAATGAATATCCAGTA Gene: Spro_4439: single-strand binding protein	* Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -158 score = 5.47797 sequence = AACTGAATGAATATCCAGTA Gene: ECA3690: single-strand binding protein	* Edwardsiella tarda EIB202 Site: position = -155 score = 5.3253 sequence = AACTGAATGGATATCCAGTA Gene: ETAE_3183: single-strand binding protein	* Proteus mirabilis HI4320 Site: position = -188 score = 5.30376 sequence = AGCTGAATGGATATACAGTA Gene: PMI2747: single-strand binding protein	* Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -169 score = 5.28492 sequence = GACTGATTAGATATACAGTA Gene: plu4349: single-strand binding protein	single-strand binding protein
CRON 27.
yjiW	* Escherichia coli str. K-12 substr. MG1655 Site: position = -95 score = 4.99929 sequence = TACTGATGATATATACAGGT Gene: b4347: LexA regulated, putative SOS response	* Salmonella typhimurium LT2 Site: position = -94 score = 4.36594 sequence = TACTGATGTTATGTACAGGT Gene: STM4523: LexA regulated, putative SOS response	Citrobacter koseri ATCC BAA-895	Klebsiella pneumoniae subsp. pneumoniae MGH 78578	Enterobacter sp. 638	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	LexA regulated, putative SOS response
CRON 28.
ybfE	* Escherichia coli str. K-12 substr. MG1655 Site: position = -136 score = 4.46557 sequence = AACTGATTAAAAACCCAGCG Gene: b0685: LexA regulated protein	Salmonella typhimurium LT2 Gene: STM0695: LexA regulated protein	Citrobacter koseri ATCC BAA-895	Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Gene: KPN_00708: LexA regulated protein	Enterobacter sp. 638 Gene: Ent638_1200: LexA regulated protein	Erwinia amylovora ATCC 49946 Gene: EAM_1153: LexA regulated protein	Yersinia pestis KIM Gene: y1211: LexA regulated protein	Serratia proteamaculans 568 Gene: Spro_1238: LexA regulated protein	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202 Gene: ETAE_2608: LexA regulated protein	Proteus mirabilis HI4320 Gene: PMI0545: LexA regulated protein	Photorhabdus luminescens subsp. laumondii TTO1 Gene: plu1329: LexA regulated protein	LexA regulated protein
CRON 29.
samA	Escherichia coli str. K-12 substr. MG1655	* Salmonella typhimurium LT2 Site: position = -37 score = 5.23723 sequence = TGCTGTATATAAAAACAGGC Gene: PSLT055: UV protection protein	Citrobacter koseri ATCC BAA-895	Klebsiella pneumoniae subsp. pneumoniae MGH 78578	Enterobacter sp. 638	* Erwinia amylovora ATCC 49946 Site: position = -35 score = 5.97269 sequence = TACTGTATATGCATACAGTA Gene: EAM_P216: UV protection protein	Yersinia pestis KIM	Serratia proteamaculans 568	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	UV protection protein
samB	Escherichia coli str. K-12 substr. MG1655	Salmonella typhimurium LT2 Gene: PSLT054: UV protection protein	Citrobacter koseri ATCC BAA-895	Klebsiella pneumoniae subsp. pneumoniae MGH 78578	Enterobacter sp. 638	Erwinia amylovora ATCC 49946 Gene: EAM_P215: UV protection protein	Yersinia pestis KIM	Serratia proteamaculans 568	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	UV protection protein
CRON 30.
rmuC	Escherichia coli str. K-12 substr. MG1655	* Salmonella typhimurium LT2 Site: position = -64 score = 5.16836 sequence = AACTGGACGTTTATACAGCA Gene: STM3969: DNA recombination protein RmuC	* Citrobacter koseri ATCC BAA-895 Site: position = -60 score = 5.16836 sequence = AACTGGACGTTTATACAGCA Gene: CKO_00174: DNA recombination protein RmuC	* Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -60 score = 4.7327 sequence = AACTGGACGTTTGTACAGCA Gene: KPN_04328: DNA recombination protein RmuC	* Enterobacter sp. 638 Site: position = -63 score = 5.16836 sequence = AACTGGACGTTTATACAGCA Gene: Ent638_3961: DNA recombination protein RmuC	* Erwinia amylovora ATCC 49946 Site: position = -64 score = 4.53713 sequence = GTCTGGACATTTATACAGTG Gene: EAM_0201: DNA recombination protein RmuC	* Yersinia pestis KIM Site: position = -62 score = 4.61383 sequence = CTCTGGACATCCATACAGTA Gene: y0448: DNA recombination protein RmuC	* Serratia proteamaculans 568 Site: position = -86 score = 4.79724 sequence = GACTGGACATCCATACAGCA Gene: Spro_0247: DNA recombination protein RmuC	* Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -64 score = 4.85963 sequence = TTCTGGACATCCATACAGTA Gene: ECA0195: DNA recombination protein RmuC	* Edwardsiella tarda EIB202 Site: position = -63 score = 4.48595 sequence = CTCTGGACATCCATACAGTT Gene: ETAE_0146: DNA recombination protein RmuC	Proteus mirabilis HI4320 Gene: PMI3535: DNA recombination protein RmuC	* Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -65 score = 4.97659 sequence = TTCTGGACATCTATACAGTA Gene: plu4414: DNA recombination protein RmuC	DNA recombination protein RmuC
CRON 31.
yafH	* Escherichia coli str. K-12 substr. MG1655 Site: position = -73 score = 4.26233 sequence = AAATGTTTTTACATCCACTA Gene: b0221: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)	* Salmonella typhimurium LT2 Site: position = -197 score = 3.76006 sequence = TACCGGATAGCAGTACAGGC Gene: STM0309: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)	Citrobacter koseri ATCC BAA-895 Gene: CKO_02965: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)	Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Gene: KPN_00235: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)	Enterobacter sp. 638 Gene: Ent638_0758: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)	Erwinia amylovora ATCC 49946 Gene: EAM_0890: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)	Yersinia pestis KIM Gene: y0946: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)	Serratia proteamaculans 568 Gene: Spro_0949: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)	Erwinia carotovora subsp. atroseptica SCRI1043 Gene: ECA3474: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)	Edwardsiella tarda EIB202	Proteus mirabilis HI4320 Gene: PMI0348: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)	Photorhabdus luminescens subsp. laumondii TTO1 Gene: plu1192: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)	Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD