Regulon of LexA in Enterobacter sp. 638

Properties
Regulator type:	Transcription factor
TF locus tag:	Ent638_0247
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Enterobacteriales
Statistics of regulated genes:
- Genes	27
- Operons	23
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 265 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -92 Score: 5.9 Sequence: TACTGTATGACTATACAGTA Locus tag: Ent638_3174 Name: recA Funciton: Recombinase A Locus tag: Ent638_3173 Name: recX Funciton: regulatory protein RecX
	Ent638_3174	recA	Recombinase A
	Ent638_3173	recX	regulatory protein RecX
Position: -68 Score: 5.1 Sequence: TATTGTATAAATCAACAGTA Locus tag: Ent638_3979 Name: uvrD Funciton: ATP-dependent DNA helicase II
	Ent638_3979	uvrD	ATP-dependent DNA helicase II
Position: -34 Score: 6.2 Sequence: TACTGTATATTCATACAGTA Locus tag: Ent638_1470 Name: sulA Funciton: Cell division inhibitor sulA
	Ent638_1470	sulA	Cell division inhibitor sulA
Position: -37 Score: 5.8 Sequence: TACTGTATACTTATCCAGTA Locus tag: Ent638_0762 Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7)
	Ent638_0762	dinB	DNA polymerase IV (EC 2.7.7.7)
Position: -47 Score: 5 Sequence: GACTGTATATACTCACAGCA Position: -26 Score: 5.2 Sequence: AACTGTATATACACCCAGGG Locus tag: Ent638_0247 Name: lexA Funciton: LexA repressor Locus tag: Ent638_0248 Name: dinF Funciton: DNA-damage-inducible SOS response protein
	Ent638_0247	lexA	LexA repressor
	Ent638_0248	dinF	DNA-damage-inducible SOS response protein
Position: -96 Score: 5 Sequence: TCCTGTTAATCCATACAGCA Locus tag: Ent638_1414 Name: ftsK Funciton: DNA translocase FtsK
	Ent638_1414	ftsK	DNA translocase FtsK
Position: -34 Score: 5.2 Sequence: TACTGTATGAATTGACAGTT Locus tag: Ent638_1715 Name: ydjM Funciton: membrane-bound metal-dependent hydrolase
	Ent638_1715	ydjM	membrane-bound metal-dependent hydrolase
Position: -68 Score: 5.6 Sequence: TACTGTATAAAAAACCAGTT Position: -46 Score: 5.8 Sequence: TACTGTATAGAAATACAGTT Locus tag: Ent638_3096 Name: recN Funciton: DNA repair protein RecN
	Ent638_3096	recN	DNA repair protein RecN
Position: -95 Score: 5.4 Sequence: CACTGGATTTACATCCAGTA Locus tag: Ent638_1271 Name: uvrB Funciton: Excinuclease ABC subunit B
	Ent638_1271	uvrB	Excinuclease ABC subunit B
Position: -69 Score: 4.6 Sequence: GGCTGGATAAACATCCAGCC Locus tag: Ent638_2430 Name: ruvA Funciton: Holliday junction helicase subunit A Locus tag: Ent638_2429 Name: ruvB Funciton: Holliday junction DNA helicase B
	Ent638_2430	ruvA	Holliday junction helicase subunit A
	Ent638_2429	ruvB	Holliday junction DNA helicase B
Position: -39 Score: 5.8 Sequence: GACTGTATAAATAAACAGTA Locus tag: Ent638_1575 Name: dinI Funciton: DNA damage-inducible protein
	Ent638_1575	dinI	DNA damage-inducible protein
Position: -33 Score: 5.3 Sequence: CACTGTATATAATTACAGTG Locus tag: Ent638_1887 Name: yebG Funciton: SOS regulon DNA damage-inducible protein
	Ent638_1887	yebG	SOS regulon DNA damage-inducible protein
Position: -165 Score: 5.7 Sequence: ACCTGTTTGAATATACAGTA Locus tag: Ent638_0262 Name: ssb Funciton: single-strand binding protein
	Ent638_0262	ssb	single-strand binding protein
Position: -34 Score: 4.8 Sequence: TAGTGGCTGTTTATACAGTA Locus tag: Ent638_1289 Name: dinG Funciton: ATP-dependent helicase DinG/Rad3
	Ent638_1289	dinG	ATP-dependent helicase DinG/Rad3
Position: -33 Score: 5 Sequence: CACTGTATAGCTGAACAGTA Locus tag: Ent638_1703 Name: cho Funciton: endonuclease of nucleotide excision repair
	Ent638_1703	cho	endonuclease of nucleotide excision repair
Position: -70 Score: 4.9 Sequence: TGCTGTTTTTATAAACAATG Locus tag: Ent638_3474 Name: null Funciton: DNA glycosylase, G/U mismatch specific
	Ent638_3474		DNA glycosylase, G/U mismatch specific
Position: -32 Score: 5.7 Sequence: TGCTGTATATAAAAACAGTT Locus tag: Ent638_1656 Name: dinI Funciton: DNA damage-inducible protein
	Ent638_1656	dinI	DNA damage-inducible protein
Position: -38 Score: 5.5 Sequence: CACTGTATAAATGTACAGTT Locus tag: Ent638_2256 Name: dinI Funciton: DNA damage-inducible protein
	Ent638_2256	dinI	DNA damage-inducible protein
Position: -100 Score: 5.7 Sequence: TACTGTATATTCAAACAGGT Locus tag: Ent638_0261 Name: uvrA Funciton: excinuclease ABC subunit A
	Ent638_0261	uvrA	excinuclease ABC subunit A
Position: 30 Score: 4.6 Sequence: ACCTGTATAAAATCCCAGCA Locus tag: Ent638_0607 Name: polB Funciton: DNA polymerase II (EC 2.7.7.7)
	Ent638_0607	polB	DNA polymerase II (EC 2.7.7.7)
Position: -34 Score: 5.9 Sequence: TACTGTATGTAAAAACAGTA Locus tag: Ent638_2213 Name: umuD Funciton: DNA polymerase V, subunit UmuD Locus tag: Ent638_2212 Name: umuC Funciton: DNA polymerase V, subunit UmuC
	Ent638_2213	umuD	DNA polymerase V, subunit UmuD
	Ent638_2212	umuC	DNA polymerase V, subunit UmuC
Position: -35 Score: 5.3 Sequence: TAGTGTATAAATACACAGTA Locus tag: Ent638_2577 Name: sbmC Funciton: DNA gyrase inhibitor
	Ent638_2577	sbmC	DNA gyrase inhibitor
Position: -63 Score: 5.2 Sequence: AACTGGACGTTTATACAGCA Locus tag: Ent638_3961 Name: rmuC Funciton: DNA recombination protein RmuC
	Ent638_3961	rmuC	DNA recombination protein RmuC

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of LexA in Enterobacter sp. 638

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --