Regulon of LexA in Escherichia coli str. K-12 substr. MG1655

Properties
Regulator type:	Transcription factor
TF locus tag:	b4043
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Enterobacteriales
Statistics of regulated genes:
- Genes	30
- Operons	26
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 265 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -76 Score: 4.9 Sequence: ATCTGTATATATACCCAGCT Locus tag: b3813 Name: uvrD Funciton: ATP-dependent DNA helicase II
	b3813	uvrD	ATP-dependent DNA helicase II
Position: -79 Score: 5.7 Sequence: TACTGTATGAGCATACAGTA Locus tag: b2699 Name: recA Funciton: Recombinase A Locus tag: b2698 Name: recX Funciton: regulatory protein RecX
	b2699	recA	Recombinase A
	b2698	recX	regulatory protein RecX
Position: -42 Score: 5.6 Sequence: TACTGTACATCCATACAGTA Locus tag: b0958 Name: sulA Funciton: Cell division inhibitor sulA
	b0958	sulA	Cell division inhibitor sulA
Position: -34 Score: 4.8 Sequence: CACTGTATACTTTACCAGTG Locus tag: b0231 Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7)
	b0231	dinB	DNA polymerase IV (EC 2.7.7.7)
Position: -47 Score: 5.1 Sequence: TGCTGTATATACTCACAGCA Position: -26 Score: 5.2 Sequence: AACTGTATATACACCCAGGG Locus tag: b4043 Name: lexA Funciton: LexA repressor Locus tag: b4044 Name: dinF Funciton: DNA-damage-inducible SOS response protein
	b4043	lexA	LexA repressor
	b4044	dinF	DNA-damage-inducible SOS response protein
Position: -96 Score: 5 Sequence: TCCTGTTAATCCATACAGCA Locus tag: b0890 Name: ftsK Funciton: DNA translocase FtsK
	b0890	ftsK	DNA translocase FtsK
Position: -52 Score: 4.4 Sequence: CACTGTATAAAAATCCTATA Position: -34 Score: 4.7 Sequence: TACTGTACGTATCGACAGTT Locus tag: b1728 Name: ydjM Funciton: membrane-bound metal-dependent hydrolase
	b1728	ydjM	membrane-bound metal-dependent hydrolase
Position: -68 Score: 5.7 Sequence: TACTGTATATAAAACCAGTT Position: -46 Score: 4.9 Sequence: TACTGTACACAATAACAGTA Position: -28 Score: 4.7 Sequence: TAATGGTTTTTCATACAGGA Locus tag: b2616 Name: recN Funciton: DNA repair protein RecN
	b2616	recN	DNA repair protein RecN
Position: -39 Score: 5.6 Sequence: ACCTGTATAAATAACCAGTA Locus tag: b1061 Name: dinI Funciton: DNA damage-inducible protein
	b1061	dinI	DNA damage-inducible protein
Position: -94 Score: 5.6 Sequence: AACTGTTTTTTTATCCAGTA Locus tag: b0779 Name: uvrB Funciton: Excinuclease ABC subunit B
	b0779	uvrB	Excinuclease ABC subunit B
Position: -69 Score: 5 Sequence: CGCTGGATATCTATCCAGCA Locus tag: b1861 Name: ruvA Funciton: Holliday junction helicase subunit A Locus tag: b1860 Name: ruvB Funciton: Holliday junction DNA helicase B
	b1861	ruvA	Holliday junction helicase subunit A
	b1860	ruvB	Holliday junction DNA helicase B
Position: -37 Score: 5.3 Sequence: TACTGTATAAAATCACAGTT Locus tag: b1848 Name: yebG Funciton: SOS regulon DNA damage-inducible protein
	b1848	yebG	SOS regulon DNA damage-inducible protein
Position: -170 Score: 5.5 Sequence: ACCTGAATGAATATACAGTA Locus tag: b4059 Name: ssb Funciton: single-strand binding protein
	b4059	ssb	single-strand binding protein
Position: -34 Score: 4.9 Sequence: TATTGGCTGTTTATACAGTA Locus tag: b0799 Name: dinG Funciton: ATP-dependent helicase DinG/Rad3
	b0799	dinG	ATP-dependent helicase DinG/Rad3
Position: -33 Score: 5.1 Sequence: CACTGGATAGATAACCAGCA Locus tag: b1741 Name: cho Funciton: endonuclease of nucleotide excision repair
	b1741	cho	endonuclease of nucleotide excision repair
Position: -69 Score: 4.9 Sequence: TGCTGTTTTTATAAACAATG Locus tag: b3068 Name: ygjF Funciton: DNA glycosylase, G/U mismatch specific
	b3068	ygjF	DNA glycosylase, G/U mismatch specific
Position: -254 Score: 6.1 Sequence: TACTGTTTATTTATACAGTA Locus tag: b4618 Name: tisB Funciton: lexA-regulated toxic peptide
	b4618	tisB	lexA-regulated toxic peptide
Position: -63 Score: 5.9 Sequence: AACTGTATATAAATACAGTT Locus tag: b3645 Name: dinD Funciton: DNA-damage-inducible protein
	b3645	dinD	DNA-damage-inducible protein
Position: -188 Score: 4.3 Sequence: TGCTGGTTTTATAACCTGCA Position: -166 Score: 5.7 Sequence: TACTGTATGATTATCCAGTT Locus tag: b4613 Name: dinQ Funciton: Damage inducible, function unknown
	b4613	dinQ	Damage inducible, function unknown
Position: -95 Score: 5 Sequence: TACTGATGATATATACAGGT Locus tag: b4347 Name: yjiW Funciton: LexA regulated, putative SOS response
	b4347	yjiW	LexA regulated, putative SOS response
Position: -73 Score: 4.3 Sequence: GACTGTATAAAACCACAGCC Locus tag: b0060 Name: polB Funciton: DNA polymerase II (EC 2.7.7.7)
	b0060	polB	DNA polymerase II (EC 2.7.7.7)
Position: -103 Score: 5.5 Sequence: TACTGTATATTCATTCAGGT Locus tag: b4058 Name: uvrA Funciton: excinuclease ABC subunit A
	b4058	uvrA	excinuclease ABC subunit A
Position: -136 Score: 4.5 Sequence: AACTGATTAAAAACCCAGCG Locus tag: b0685 Name: ybfE Funciton: LexA regulated protein
	b0685	ybfE	LexA regulated protein
Position: -39 Score: 6.1 Sequence: TACTGTATATAAAAACAGTA Locus tag: b1183 Name: umuD Funciton: DNA polymerase V, subunit UmuD Locus tag: b1184 Name: umuC Funciton: DNA polymerase V, subunit UmuC
	b1183	umuD	DNA polymerase V, subunit UmuD
	b1184	umuC	DNA polymerase V, subunit UmuC
Position: -34 Score: 6.1 Sequence: TACTGTATATAAAAACAGTA Locus tag: b2009 Name: sbmC Funciton: DNA gyrase inhibitor
	b2009	sbmC	DNA gyrase inhibitor
Position: -73 Score: 4.3 Sequence: AAATGTTTTTACATCCACTA Locus tag: b0221 Name: yafH Funciton: Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)
	b0221	yafH	Acyl-CoA dehydrogenase, short-chain specific (EC 1.3.99.2)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of LexA in Escherichia coli str. K-12 substr. MG1655

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --