Regulon of LexA in Photorhabdus luminescens subsp. laumondii TTO1

Properties
Regulator type:	Transcription factor
TF locus tag:	plu4374
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Enterobacteriales
Statistics of regulated genes:
- Genes	16
- Operons	15
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 265 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -55 Score: 5 Sequence: TTCTGTATAAAAACACAGCA Locus tag: plu4636 Name: uvrD Funciton: ATP-dependent DNA helicase II
	plu4636	uvrD	ATP-dependent DNA helicase II
Position: -100 Score: 5.8 Sequence: TGCTGTATGATTATACAGTA Locus tag: plu1249 Name: recA Funciton: Recombinase A
	plu1249	recA	Recombinase A
Position: -40 Score: 6 Sequence: TACTGTATATTAATACAGTT Locus tag: plu1776 Name: sulA Funciton: Cell division inhibitor sulA
	plu1776	sulA	Cell division inhibitor sulA
Position: -42 Score: 4.8 Sequence: TTATGTATGTTTATACAGTT Locus tag: plu1239 Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7)
	plu1239	dinB	DNA polymerase IV (EC 2.7.7.7)
Position: -26 Score: 5.2 Sequence: GACTGTATAAACAAACAGGG Locus tag: plu4374 Name: lexA Funciton: LexA repressor
	plu4374	lexA	LexA repressor
Position: -81 Score: 5.5 Sequence: TCCTGTTTATGCATACAGTT Locus tag: plu1601 Name: ftsK Funciton: DNA translocase FtsK
	plu1601	ftsK	DNA translocase FtsK
Position: -37 Score: 5 Sequence: GACTGTATGGATAGACAGTT Locus tag: plu2679 Name: ydjM Funciton: membrane-bound metal-dependent hydrolase
	plu2679	ydjM	membrane-bound metal-dependent hydrolase
Position: -68 Score: 5.6 Sequence: TACTGTATAAAAAACCAGTT Position: -46 Score: 4.8 Sequence: TACTGTATGAAGATACAGAG Position: -28 Score: 4.5 Sequence: AGGTGTTTTTATACACAGGA Locus tag: plu3374 Name: recN Funciton: DNA repair protein RecN
	plu3374	recN	DNA repair protein RecN
Position: -56 Score: 5.3 Sequence: AGCTGGTTTTATATCCAGTA Locus tag: plu1491 Name: uvrB Funciton: Excinuclease ABC subunit B
	plu1491	uvrB	Excinuclease ABC subunit B
Position: -85 Score: 4.6 Sequence: GGCTGGATATGCATCCAGCT Locus tag: plu2111 Name: ruvA Funciton: Holliday junction helicase subunit A Locus tag: plu2112 Name: ruvB Funciton: Holliday junction DNA helicase B
	plu2111	ruvA	Holliday junction helicase subunit A
	plu2112	ruvB	Holliday junction DNA helicase B
Position: -65 Score: 5.1 Sequence: ACTTGTATATCTATACAGTT Locus tag: plu0292 Name: tag Funciton: DNA-3-methyladenine glycosylase I
	plu0292	tag	DNA-3-methyladenine glycosylase I
Position: -169 Score: 5.3 Sequence: GACTGATTAGATATACAGTA Locus tag: plu4349 Name: ssb Funciton: single-strand binding protein
	plu4349	ssb	single-strand binding protein
Position: -65 Score: 5.7 Sequence: TACTGTTTATATGAACAGTA Locus tag: plu1815 Name: dinI Funciton: DNA damage-inducible protein
	plu1815	dinI	DNA damage-inducible protein
Position: -209 Score: 5.3 Sequence: TACTGTATATCTAATCAGTC Locus tag: plu4350 Name: uvrA Funciton: excinuclease ABC subunit A
	plu4350	uvrA	excinuclease ABC subunit A
Position: -65 Score: 5 Sequence: TTCTGGACATCTATACAGTA Locus tag: plu4414 Name: rmuC Funciton: DNA recombination protein RmuC
	plu4414	rmuC	DNA recombination protein RmuC

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of LexA in Photorhabdus luminescens subsp. laumondii TTO1

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --