Regulon of LexA in Citrobacter koseri ATCC BAA-895

Properties
Regulator type:	Transcription factor
TF locus tag:	CKO_03872
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Enterobacteriales
Statistics of regulated genes:
- Genes	22
- Operons	21
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 265 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -60 Score: 5.2 Sequence: AACTGGACGTTTATACAGCA Locus tag: CKO_00174 Name: rmuC Funciton: DNA recombination protein RmuC
	CKO_00174	rmuC	DNA recombination protein RmuC
Position: -76 Score: 5 Sequence: TATTGTATATATACCCAGCT Locus tag: CKO_00155 Name: uvrD Funciton: ATP-dependent DNA helicase II
	CKO_00155	uvrD	ATP-dependent DNA helicase II
Position: -96 Score: 5.5 Sequence: TACTGTATGACTGTACAGTA Locus tag: CKO_04050 Name: recA Funciton: Recombinase A
	CKO_04050	recA	Recombinase A
Position: -41 Score: 6 Sequence: TACTGTATATCCATACAGTA Locus tag: CKO_02110 Name: sulA Funciton: Cell division inhibitor sulA
	CKO_02110	sulA	Cell division inhibitor sulA
Position: -35 Score: 5.8 Sequence: TACTGTATACTTAAACAGTA Locus tag: CKO_02960 Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7)
	CKO_02960	dinB	DNA polymerase IV (EC 2.7.7.7)
Position: -47 Score: 5 Sequence: AGCTGTATATACTCACAGCA Position: -26 Score: 5.2 Sequence: AACTGTATATACACCCAGGG Locus tag: CKO_03872 Name: lexA Funciton: LexA repressor
	CKO_03872	lexA	LexA repressor
Position: -39 Score: 5 Sequence: TCCTGTTAATCCATACAGCA Locus tag: CKO_02181 Name: ftsK Funciton: DNA translocase FtsK
	CKO_02181	ftsK	DNA translocase FtsK
Position: -52 Score: 4.4 Sequence: TACTGTATAAAAACCCTATA Position: -34 Score: 5.2 Sequence: TACTGTATGAATTGACAGTT Locus tag: CKO_01754 Name: ydjM Funciton: membrane-bound metal-dependent hydrolase
	CKO_01754	ydjM	membrane-bound metal-dependent hydrolase
Position: -68 Score: 5.6 Sequence: TACTGTATAAAAAACCAGTT Position: -46 Score: 5.1 Sequence: TACTGTATGTAATCACAGTC Position: -28 Score: 4.5 Sequence: TCATGGTTTTTCATACAGGA Locus tag: CKO_03938 Name: recN Funciton: DNA repair protein RecN
	CKO_03938	recN	DNA repair protein RecN
Position: -93 Score: 5.4 Sequence: CACTGTTTTTTCATCCAGTA Locus tag: CKO_02348 Name: uvrB Funciton: Excinuclease ABC subunit B
	CKO_02348	uvrB	Excinuclease ABC subunit B
Position: -39 Score: 5.9 Sequence: AACTGTATAAATACACAGTA Locus tag: CKO_02002 Name: dinI Funciton: DNA damage-inducible protein
	CKO_02002	dinI	DNA damage-inducible protein
Position: -70 Score: 4.6 Sequence: GGCTGGATATCTATCCAGCC Locus tag: CKO_01099 Name: ruvA Funciton: Holliday junction helicase subunit A
	CKO_01099	ruvA	Holliday junction helicase subunit A
Position: -38 Score: 4.8 Sequence: TGCTGTACATAATTACAGGT Locus tag: CKO_01118 Name: yebG Funciton: SOS regulon DNA damage-inducible protein
	CKO_01118	yebG	SOS regulon DNA damage-inducible protein
Position: -168 Score: 5.3 Sequence: ACCTGAATGGATATACAGTA Locus tag: CKO_03842 Name: ssb Funciton: single-strand binding protein
	CKO_03842	ssb	single-strand binding protein
Position: -34 Score: 4.8 Sequence: TAGTGGCTGTTTATACAGTA Locus tag: CKO_02329 Name: dinG Funciton: ATP-dependent helicase DinG/Rad3
	CKO_02329	dinG	ATP-dependent helicase DinG/Rad3
Position: -70 Score: 4.7 Sequence: TGCTGTTTTTATAAACAACG Locus tag: CKO_04467 Name: null Funciton: DNA glycosylase, G/U mismatch specific
	CKO_04467		DNA glycosylase, G/U mismatch specific
Position: -25 Score: 6.1 Sequence: TACTGTATAaAaATACAGTA Locus tag: CKO_01890 Name: dinI Funciton: DNA damage-inducible protein
	CKO_01890	dinI	DNA damage-inducible protein
Position: -102 Score: 5.3 Sequence: TACTGTATATCCATTCAGGT Locus tag: CKO_03843 Name: uvrA Funciton: excinuclease ABC subunit A
	CKO_03843	uvrA	excinuclease ABC subunit A
Position: -73 Score: 4.7 Sequence: ACCTGTATAAAACCACAGCA Locus tag: CKO_03322 Name: polB Funciton: DNA polymerase II (EC 2.7.7.7)
	CKO_03322	polB	DNA polymerase II (EC 2.7.7.7)
Position: -38 Score: 5.9 Sequence: TACTGTATATATAATCAGTA Locus tag: CKO_01842 Name: umuD Funciton: DNA polymerase V, subunit UmuD Locus tag: CKO_01841 Name: umuC Funciton: DNA polymerase V, subunit UmuC
	CKO_01842	umuD	DNA polymerase V, subunit UmuD
	CKO_01841	umuC	DNA polymerase V, subunit UmuC
Position: -157 Score: 5.7 Sequence: TGCTGTGTTTATATACAGTA Locus tag: CKO_00775 Name: sbmC Funciton: DNA gyrase inhibitor
	CKO_00775	sbmC	DNA gyrase inhibitor

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of LexA in Citrobacter koseri ATCC BAA-895

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --