Regulog IscR - Enterobacteriales

Properties
Regulator type:	Transcription factor
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 45 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Statistics of regulated genes
Genome	Genes	Operons
Escherichia coli str. K-12 substr. MG1655	10	3
Salmonella typhimurium LT2	10	3
Citrobacter koseri ATCC BAA-895	10	3
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	10	3
Enterobacter sp. 638	10	3
Erwinia amylovora ATCC 49946	3	2
Yersinia pestis KIM	11	3
Serratia proteamaculans 568	10	3
Erwinia carotovora subsp. atroseptica SCRI1043	9	2
Edwardsiella tarda EIB202	10	3
Proteus mirabilis HI4320	9	2
Photorhabdus luminescens subsp. laumondii TTO1	10	3

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes													Function

CRON 1.
erpA	* Escherichia coli str. K-12 substr. MG1655 Site: position = -89 score = 4.94338 sequence = ATACTTGAACGAAATACCAGGGTAT Gene: b0156: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Salmonella typhimurium LT2 Site: position = -89 score = 4.89901 sequence = ATACTTGAACGAATTACCAGGGTAT Gene: STM0204.S: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Citrobacter koseri ATCC BAA-895 Site: position = -88 score = 5.19351 sequence = ATACTTGAATGAAATACCAGGGTAT Gene: CKO_03211: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -89 score = 4.6771 sequence = ATACTTGAACGATTTACCAGGGTAT Gene: KPN_00171: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Enterobacter sp. 638 Site: position = -87 score = 5.14915 sequence = ATACTTGAATGAATTACCAGGGTAT Gene: Ent638_0696: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	Erwinia amylovora ATCC 49946 Gene: EAM_0810: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Yersinia pestis KIM Site: position = -103 score = 5.98651 sequence = GTACTTGAATGAAATACTCAGGTAT Gene: y0801: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Serratia proteamaculans 568 Site: position = -97 score = 5.51907 sequence = ATACTTGAACGCAACACTCAGGTAT Gene: Spro_0783: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	Erwinia carotovora subsp. atroseptica SCRI1043 Gene: ECA3306: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Edwardsiella tarda EIB202 Site: position = -99 score = 5.82045 sequence = ATACTTGAATGGATTACTCGGGTAT Gene: ETAE_2776: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	Proteus mirabilis HI4320 Gene: PMI0206: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -105 score = 5.20625 sequence = AAACTTGAACGAACTAATCAGGTAT Gene: plu0904: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family

CRON 2.
nfuA	* Escherichia coli str. K-12 substr. MG1655 Site: position = -37 score = 6.8805 sequence = ATAACCAACTAAAATAGTCAACTAT Gene: b3414: NfuA Fe-S protein maturation	* Salmonella typhimurium LT2 Site: position = -37 score = 6.8805 sequence = ATAACCAACTAAAATAGTCAACTAT Gene: STM3511: NfuA Fe-S protein maturation	* Citrobacter koseri ATCC BAA-895 Site: position = -37 score = 6.68207 sequence = ATAACCAAGTAAAATAGTCAACTAT Gene: CKO_04835: NfuA Fe-S protein maturation	* Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -37 score = 6.47826 sequence = ATAACCCAGTAAAATAGTCAACTAT Gene: KPN_03784: NfuA Fe-S protein maturation	* Enterobacter sp. 638 Site: position = -37 score = 6.08785 sequence = ATACCCAAGTATTTTAGTCAACTAT Gene: Ent638_3827: NfuA Fe-S protein maturation	* Erwinia amylovora ATCC 49946 Site: position = -37 score = 6.6824 sequence = ATAACCAACTGAATTAGTCAACTAT Gene: EAM_3259: NfuA Fe-S protein maturation	* Yersinia pestis KIM Site: position = -37 score = 6.33379 sequence = ATAACCGACAAGAGTAGTCAACTAT Gene: y3903: NfuA Fe-S protein maturation	* Serratia proteamaculans 568 Site: position = -46 score = 5.70434 sequence = ATAACCTAGTATAGAAGTCAACTAT Gene: Spro_4634: NfuA Fe-S protein maturation	* Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -38 score = 5.64662 sequence = ATAACCGATAAGTGCAGTCAACTAT Gene: ECA4134: NfuA Fe-S protein maturation	* Edwardsiella tarda EIB202 Site: position = -37 score = 5.88631 sequence = ATAACCGACCGGAGAAGTCAACTAT Gene: ETAE_3288: NfuA Fe-S protein maturation	* Proteus mirabilis HI4320 Site: position = -38 score = 6.26426 sequence = ATAACCAACCAGAACAGTCAACTAT Gene: PMI2926: NfuA Fe-S protein maturation	* Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -37 score = 6.33119 sequence = ATAACCAACTATAGCAGTCAACTAT Gene: plu0198: NfuA Fe-S protein maturation	NfuA Fe-S protein maturation

CRON 3.
iscR	* Escherichia coli str. K-12 substr. MG1655 Site: position = -133 score = 6.70926 sequence = ATACCCGACTAAATCAGTCAAGTAA Site: position = -108 score = 5.84037 sequence = ATAGTTGACCAATTTACTCGGGAAT Gene: b2531: Iron-sulfur cluster regulator IscR	* Salmonella typhimurium LT2 Site: position = -107 score = 6.06229 sequence = ATAGTTGACCAAATTACTCGGGAAT Site: position = -132 score = 6.53852 sequence = ATACCTGACTAATTTACTCAAGTAA Gene: STM2544: Iron-sulfur cluster regulator IscR	* Citrobacter koseri ATCC BAA-895 Site: position = -132 score = 6.84887 sequence = ATACCTGACTAAATTAGTCAAGTAA Site: position = -107 score = 6.02522 sequence = ATAGTTGACTGATTTAGTCGGGAAT Gene: CKO_00250: Iron-sulfur cluster regulator IscR	* Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -127 score = 6.77727 sequence = ATACCTGACTAAAACAGTCAAGTAA Site: position = -102 score = 6.06229 sequence = ATAGTTGACCAAATTACTCGGGAAT Gene: KPN_02863: Iron-sulfur cluster regulator IscR	* Enterobacter sp. 638 Site: position = -131 score = 6.77727 sequence = ATACCTGACTAAAACAGTCAAGTAA Site: position = -106 score = 5.92881 sequence = ATAGTTGACCAATTTAGTCGGGAAT Gene: Ent638_3028: Iron-sulfur cluster regulator IscR	* Erwinia amylovora ATCC 49946 Site: position = -88 score = 5.87945 sequence = ATACTTGACCAATTTACTCGGGAAT Site: position = -138 score = 4.88166 sequence = ATAGTTGAGTAAATTACCAGGTTAA Gene: EAM_2493: Iron-sulfur cluster regulator IscR	* Yersinia pestis KIM Site: position = -29 score = 5.25629 sequence = ATAGTTGAGTGAATTACTAGGTTAA Site: position = -4 score = 6.57761 sequence = ATAGTTGACTAAAACACTCAAGAAT Gene: y1333: Iron-sulfur cluster regulator IscR	* Serratia proteamaculans 568 Site: position = -94 score = 5.44909 sequence = ATACTTGAGTAAATTACTAGGTTAA Site: position = -69 score = 6.20142 sequence = ATAGTTGACTGATTTACTCAGGAAT Gene: Spro_3628: Iron-sulfur cluster regulator IscR	* Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -80 score = 6.24082 sequence = ATAGTTGACTAAAACACTCGGGAAT Site: position = -105 score = 5.16957 sequence = ATACTTGAGTGTTTTACTCGGTTAA Gene: ECA3238: Iron-sulfur cluster regulator IscR	* Edwardsiella tarda EIB202 Site: position = -114 score = 5.72339 sequence = ATACCTGACTAAAATAGTAGGATAA Site: position = -89 score = 6.55613 sequence = ATAGTTGACTGAAATAGTCAGGAAT Gene: ETAE_2816: Iron-sulfur cluster regulator IscR	* Proteus mirabilis HI4320 Site: position = -88 score = 6.17671 sequence = ATACCTGACTAAAACACTCAGATAA Site: position = -63 score = 6.57706 sequence = ATAGTTGACTAAATTACTCAGGAAT Gene: PMI1861: Iron-sulfur cluster regulator IscR	* Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -90 score = 5.41002 sequence = ATAGTTGAGTAAATTACTAGGTTAA Site: position = -65 score = 6.62142 sequence = ATAGTTGACTAAAATACTCAGGAAT Gene: plu3284: Iron-sulfur cluster regulator IscR	Iron-sulfur cluster regulator IscR
iscS	Escherichia coli str. K-12 substr. MG1655 Gene: b2530: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Salmonella typhimurium LT2 Gene: STM2543: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Citrobacter koseri ATCC BAA-895 Gene: CKO_00251: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Gene: KPN_02862: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Enterobacter sp. 638 Gene: Ent638_3027: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Erwinia amylovora ATCC 49946 Gene: EAM_2492: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Yersinia pestis KIM Gene: y1334: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Serratia proteamaculans 568 Gene: Spro_3627: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Erwinia carotovora subsp. atroseptica SCRI1043 Gene: ECA3237: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Edwardsiella tarda EIB202 Gene: ETAE_2815: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Proteus mirabilis HI4320 Gene: PMI1860: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Photorhabdus luminescens subsp. laumondii TTO1 Gene: plu3283: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
iscU	Escherichia coli str. K-12 substr. MG1655 Gene: b2529: Iron-sulfur cluster assembly scaffold protein IscU	Salmonella typhimurium LT2 Gene: STM2542: Iron-sulfur cluster assembly scaffold protein IscU	Citrobacter koseri ATCC BAA-895 Gene: CKO_00252: Iron-sulfur cluster assembly scaffold protein IscU	Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Gene: KPN_02861: Iron-sulfur cluster assembly scaffold protein IscU	Enterobacter sp. 638 Gene: Ent638_3026: Iron-sulfur cluster assembly scaffold protein IscU	Erwinia amylovora ATCC 49946	Yersinia pestis KIM Gene: y1335: Iron-sulfur cluster assembly scaffold protein IscU	Serratia proteamaculans 568 Gene: Spro_3626: Iron-sulfur cluster assembly scaffold protein IscU	Erwinia carotovora subsp. atroseptica SCRI1043 Gene: ECA3236: Iron-sulfur cluster assembly scaffold protein IscU	Edwardsiella tarda EIB202 Gene: ETAE_2814: Iron-sulfur cluster assembly scaffold protein IscU	Proteus mirabilis HI4320 Gene: PMI1859: Iron-sulfur cluster assembly scaffold protein IscU	Photorhabdus luminescens subsp. laumondii TTO1 Gene: plu3282: Iron-sulfur cluster assembly scaffold protein IscU	Iron-sulfur cluster assembly scaffold protein IscU
iscA	Escherichia coli str. K-12 substr. MG1655 Gene: b2528: Iron binding protein IscA for iron-sulfur cluster assembly	Salmonella typhimurium LT2 Gene: STM2541: Iron binding protein IscA for iron-sulfur cluster assembly	Citrobacter koseri ATCC BAA-895 Gene: CKO_00253: Iron binding protein IscA for iron-sulfur cluster assembly	Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Gene: KPN_02860: Iron binding protein IscA for iron-sulfur cluster assembly	Enterobacter sp. 638 Gene: Ent638_3025: Iron binding protein IscA for iron-sulfur cluster assembly	Erwinia amylovora ATCC 49946	Yersinia pestis KIM Gene: y1336: Iron binding protein IscA for iron-sulfur cluster assembly	Serratia proteamaculans 568 Gene: Spro_3625: Iron binding protein IscA for iron-sulfur cluster assembly	Erwinia carotovora subsp. atroseptica SCRI1043 Gene: ECA3235: Iron binding protein IscA for iron-sulfur cluster assembly	Edwardsiella tarda EIB202 Gene: ETAE_2813: Iron binding protein IscA for iron-sulfur cluster assembly	Proteus mirabilis HI4320 Gene: PMI1858: Iron binding protein IscA for iron-sulfur cluster assembly	Photorhabdus luminescens subsp. laumondii TTO1 Gene: plu3281: Iron binding protein IscA for iron-sulfur cluster assembly	Iron binding protein IscA for iron-sulfur cluster assembly
y1337	Escherichia coli str. K-12 substr. MG1655	Salmonella typhimurium LT2	Citrobacter koseri ATCC BAA-895	Klebsiella pneumoniae subsp. pneumoniae MGH 78578	Enterobacter sp. 638	Erwinia amylovora ATCC 49946	Yersinia pestis KIM Gene: y1337: hypothetical	Serratia proteamaculans 568	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	unknown
hscB	Escherichia coli str. K-12 substr. MG1655 Gene: b2527: co-chaperone protein HscB	Salmonella typhimurium LT2 Gene: STM2540: co-chaperone protein HscB	Citrobacter koseri ATCC BAA-895 Gene: CKO_00254: co-chaperone protein HscB	Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Gene: KPN_02859: co-chaperone protein HscB	Enterobacter sp. 638 Gene: Ent638_3024: co-chaperone protein HscB	Erwinia amylovora ATCC 49946	Yersinia pestis KIM Gene: y1338: co-chaperone protein HscB	Serratia proteamaculans 568 Gene: Spro_3624: co-chaperone protein HscB	Erwinia carotovora subsp. atroseptica SCRI1043 Gene: ECA3234: co-chaperone protein HscB	Edwardsiella tarda EIB202 Gene: ETAE_2812: co-chaperone protein HscB	Proteus mirabilis HI4320 Gene: PMI1857: co-chaperone protein HscB	Photorhabdus luminescens subsp. laumondii TTO1 Gene: plu3280: co-chaperone protein HscB	Chaperone protein hscB (HSC20)
hscA	Escherichia coli str. K-12 substr. MG1655 Gene: b2526: Chaperone protein HscA	Salmonella typhimurium LT2 Gene: STM2539: Chaperone protein HscA	Citrobacter koseri ATCC BAA-895 Gene: CKO_00255: Chaperone protein HscA	Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Gene: KPN_02858: Chaperone protein HscA	Enterobacter sp. 638 Gene: Ent638_3023: Chaperone protein HscA	Erwinia amylovora ATCC 49946	Yersinia pestis KIM Gene: y1339: Chaperone protein HscA	Serratia proteamaculans 568 Gene: Spro_3623: Chaperone protein HscA	Erwinia carotovora subsp. atroseptica SCRI1043 Gene: ECA3233: Chaperone protein HscA	Edwardsiella tarda EIB202 Gene: ETAE_2811: Chaperone protein HscA	Proteus mirabilis HI4320 Gene: PMI1856: Chaperone protein HscA	Photorhabdus luminescens subsp. laumondii TTO1 Gene: plu3279: Chaperone protein HscA	Chaperone protein HscA
fdx	Escherichia coli str. K-12 substr. MG1655 Gene: b2525: ferredoxin, 2Fe-2S type, ISC system	Salmonella typhimurium LT2 Gene: STM2538: ferredoxin, 2Fe-2S type, ISC system	Citrobacter koseri ATCC BAA-895 Gene: CKO_00256: ferredoxin, 2Fe-2S type, ISC system	Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Gene: KPN_02857: ferredoxin, 2Fe-2S type, ISC system	Enterobacter sp. 638 Gene: Ent638_3022: ferredoxin, 2Fe-2S type, ISC system	Erwinia amylovora ATCC 49946	Yersinia pestis KIM Gene: y1340: ferredoxin, 2Fe-2S type, ISC system	Serratia proteamaculans 568 Gene: Spro_3622: ferredoxin, 2Fe-2S type, ISC system	Erwinia carotovora subsp. atroseptica SCRI1043 Gene: ECA3232: ferredoxin, 2Fe-2S type, ISC system	Edwardsiella tarda EIB202 Gene: ETAE_2810: ferredoxin, 2Fe-2S type, ISC system	Proteus mirabilis HI4320 Gene: PMI1855: ferredoxin, 2Fe-2S type, ISC system	Photorhabdus luminescens subsp. laumondii TTO1 Gene: plu3278: ferredoxin, 2Fe-2S type, ISC system	ferredoxin, 2Fe-2S type, ISC system
yfhJ	Escherichia coli str. K-12 substr. MG1655 Gene: b2524: putative Fe-S cluster assembly protein	Salmonella typhimurium LT2 Gene: STM2537: putative Fe-S cluster assembly protein	Citrobacter koseri ATCC BAA-895 Gene: CKO_00257: putative Fe-S cluster assembly protein	Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Gene: KPN_02856: putative Fe-S cluster assembly protein	Enterobacter sp. 638 Gene: Ent638_3021: putative Fe-S cluster assembly protein	Erwinia amylovora ATCC 49946	Yersinia pestis KIM Gene: y1341: putative Fe-S cluster assembly protein	Serratia proteamaculans 568 Gene: Spro_3621: putative Fe-S cluster assembly protein	Erwinia carotovora subsp. atroseptica SCRI1043 Gene: ECA3231: putative Fe-S cluster assembly protein	Edwardsiella tarda EIB202 Gene: ETAE_2809: putative Fe-S cluster assembly protein	Proteus mirabilis HI4320 Gene: PMI1854: putative Fe-S cluster assembly protein	Photorhabdus luminescens subsp. laumondii TTO1 Gene: plu3277: putative Fe-S cluster assembly protein	putative Fe-S cluster assembly protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog IscR - Enterobacteriales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --