Regulog IscR - Enterobacteriales
| Regulator type: | Transcription factor |
| Regulator family: | Rrf2 |
| Regulation mode: | activator (repressor) |
| Biological process: | Iron-sulfur cluster biogenesis |
| Effector: | Iron-sulfur cluster redox state |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Enterobacteriales
- By trascription factor - IscR
- By TF family - Rrf2
- By effector - Iron-sulfur cluster redox state
- By pathway - Iron-sulfur cluster biogenesis
| Genome | Genes | Operons |
|---|---|---|
| Escherichia coli str. K-12 substr. MG1655 | 10 | 3 |
| Salmonella typhimurium LT2 | 10 | 3 |
| Citrobacter koseri ATCC BAA-895 | 10 | 3 |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | 10 | 3 |
| Enterobacter sp. 638 | 10 | 3 |
| Erwinia amylovora ATCC 49946 | 3 | 2 |
| Yersinia pestis KIM | 11 | 3 |
| Serratia proteamaculans 568 | 10 | 3 |
| Erwinia carotovora subsp. atroseptica SCRI1043 | 9 | 2 |
| Edwardsiella tarda EIB202 | 10 | 3 |
| Proteus mirabilis HI4320 | 9 | 2 |
| Photorhabdus luminescens subsp. laumondii TTO1 | 10 | 3 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| erpA |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -89 score = 4.94338 sequence = ATACTTGAACGAAATACCAGGGTAT Gene: b0156: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Salmonella typhimurium LT2 Site: position = -89 score = 4.89901 sequence = ATACTTGAACGAATTACCAGGGTAT Gene: STM0204.S: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Citrobacter koseri ATCC BAA-895 Site: position = -88 score = 5.19351 sequence = ATACTTGAATGAAATACCAGGGTAT Gene: CKO_03211: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -89 score = 4.6771 sequence = ATACTTGAACGATTTACCAGGGTAT Gene: KPN_00171: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Enterobacter sp. 638 Site: position = -87 score = 5.14915 sequence = ATACTTGAATGAATTACCAGGGTAT Gene: Ent638_0696: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
Gene: EAM_0810: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Yersinia pestis KIM Site: position = -103 score = 5.98651 sequence = GTACTTGAATGAAATACTCAGGTAT Gene: y0801: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Serratia proteamaculans 568 Site: position = -97 score = 5.51907 sequence = ATACTTGAACGCAACACTCAGGTAT Gene: Spro_0783: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
Gene: ECA3306: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Edwardsiella tarda EIB202 Site: position = -99 score = 5.82045 sequence = ATACTTGAATGGATTACTCGGGTAT Gene: ETAE_2776: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
Gene: PMI0206: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -105 score = 5.20625 sequence = AAACTTGAACGAACTAATCAGGTAT Gene: plu0904: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
| CRON 2. | |||||||||||||
| nfuA |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -37 score = 6.8805 sequence = ATAACCAACTAAAATAGTCAACTAT Gene: b3414: NfuA Fe-S protein maturation |
*
Salmonella typhimurium LT2 Site: position = -37 score = 6.8805 sequence = ATAACCAACTAAAATAGTCAACTAT Gene: STM3511: NfuA Fe-S protein maturation |
*
Citrobacter koseri ATCC BAA-895 Site: position = -37 score = 6.68207 sequence = ATAACCAAGTAAAATAGTCAACTAT Gene: CKO_04835: NfuA Fe-S protein maturation |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -37 score = 6.47826 sequence = ATAACCCAGTAAAATAGTCAACTAT Gene: KPN_03784: NfuA Fe-S protein maturation |
*
Enterobacter sp. 638 Site: position = -37 score = 6.08785 sequence = ATACCCAAGTATTTTAGTCAACTAT Gene: Ent638_3827: NfuA Fe-S protein maturation |
*
Erwinia amylovora ATCC 49946 Site: position = -37 score = 6.6824 sequence = ATAACCAACTGAATTAGTCAACTAT Gene: EAM_3259: NfuA Fe-S protein maturation |
*
Yersinia pestis KIM Site: position = -37 score = 6.33379 sequence = ATAACCGACAAGAGTAGTCAACTAT Gene: y3903: NfuA Fe-S protein maturation |
*
Serratia proteamaculans 568 Site: position = -46 score = 5.70434 sequence = ATAACCTAGTATAGAAGTCAACTAT Gene: Spro_4634: NfuA Fe-S protein maturation |
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -38 score = 5.64662 sequence = ATAACCGATAAGTGCAGTCAACTAT Gene: ECA4134: NfuA Fe-S protein maturation |
*
Edwardsiella tarda EIB202 Site: position = -37 score = 5.88631 sequence = ATAACCGACCGGAGAAGTCAACTAT Gene: ETAE_3288: NfuA Fe-S protein maturation |
*
Proteus mirabilis HI4320 Site: position = -38 score = 6.26426 sequence = ATAACCAACCAGAACAGTCAACTAT Gene: PMI2926: NfuA Fe-S protein maturation |
*
Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -37 score = 6.33119 sequence = ATAACCAACTATAGCAGTCAACTAT Gene: plu0198: NfuA Fe-S protein maturation |
NfuA Fe-S protein maturation |
| CRON 3. | |||||||||||||
| iscR |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -133 score = 6.70926 sequence = ATACCCGACTAAATCAGTCAAGTAA Site: position = -108 score = 5.84037 sequence = ATAGTTGACCAATTTACTCGGGAAT Gene: b2531: Iron-sulfur cluster regulator IscR |
*
Salmonella typhimurium LT2 Site: position = -107 score = 6.06229 sequence = ATAGTTGACCAAATTACTCGGGAAT Site: position = -132 score = 6.53852 sequence = ATACCTGACTAATTTACTCAAGTAA Gene: STM2544: Iron-sulfur cluster regulator IscR |
*
Citrobacter koseri ATCC BAA-895 Site: position = -132 score = 6.84887 sequence = ATACCTGACTAAATTAGTCAAGTAA Site: position = -107 score = 6.02522 sequence = ATAGTTGACTGATTTAGTCGGGAAT Gene: CKO_00250: Iron-sulfur cluster regulator IscR |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -127 score = 6.77727 sequence = ATACCTGACTAAAACAGTCAAGTAA Site: position = -102 score = 6.06229 sequence = ATAGTTGACCAAATTACTCGGGAAT Gene: KPN_02863: Iron-sulfur cluster regulator IscR |
*
Enterobacter sp. 638 Site: position = -131 score = 6.77727 sequence = ATACCTGACTAAAACAGTCAAGTAA Site: position = -106 score = 5.92881 sequence = ATAGTTGACCAATTTAGTCGGGAAT Gene: Ent638_3028: Iron-sulfur cluster regulator IscR |
*
Erwinia amylovora ATCC 49946 Site: position = -88 score = 5.87945 sequence = ATACTTGACCAATTTACTCGGGAAT Site: position = -138 score = 4.88166 sequence = ATAGTTGAGTAAATTACCAGGTTAA Gene: EAM_2493: Iron-sulfur cluster regulator IscR |
*
Yersinia pestis KIM Site: position = -29 score = 5.25629 sequence = ATAGTTGAGTGAATTACTAGGTTAA Site: position = -4 score = 6.57761 sequence = ATAGTTGACTAAAACACTCAAGAAT Gene: y1333: Iron-sulfur cluster regulator IscR |
*
Serratia proteamaculans 568 Site: position = -94 score = 5.44909 sequence = ATACTTGAGTAAATTACTAGGTTAA Site: position = -69 score = 6.20142 sequence = ATAGTTGACTGATTTACTCAGGAAT Gene: Spro_3628: Iron-sulfur cluster regulator IscR |
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -80 score = 6.24082 sequence = ATAGTTGACTAAAACACTCGGGAAT Site: position = -105 score = 5.16957 sequence = ATACTTGAGTGTTTTACTCGGTTAA Gene: ECA3238: Iron-sulfur cluster regulator IscR |
*
Edwardsiella tarda EIB202 Site: position = -114 score = 5.72339 sequence = ATACCTGACTAAAATAGTAGGATAA Site: position = -89 score = 6.55613 sequence = ATAGTTGACTGAAATAGTCAGGAAT Gene: ETAE_2816: Iron-sulfur cluster regulator IscR |
*
Proteus mirabilis HI4320 Site: position = -88 score = 6.17671 sequence = ATACCTGACTAAAACACTCAGATAA Site: position = -63 score = 6.57706 sequence = ATAGTTGACTAAATTACTCAGGAAT Gene: PMI1861: Iron-sulfur cluster regulator IscR |
*
Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -90 score = 5.41002 sequence = ATAGTTGAGTAAATTACTAGGTTAA Site: position = -65 score = 6.62142 sequence = ATAGTTGACTAAAATACTCAGGAAT Gene: plu3284: Iron-sulfur cluster regulator IscR |
Iron-sulfur cluster regulator IscR |
| iscS |
Gene: b2530: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: STM2543: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: CKO_00251: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: KPN_02862: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: Ent638_3027: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: EAM_2492: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: y1334: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: Spro_3627: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: ECA3237: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: ETAE_2815: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: PMI1860: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: plu3283: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
| iscU |
Gene: b2529: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: STM2542: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: CKO_00252: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: KPN_02861: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: Ent638_3026: Iron-sulfur cluster assembly scaffold protein IscU |
|
Gene: y1335: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: Spro_3626: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: ECA3236: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: ETAE_2814: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: PMI1859: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: plu3282: Iron-sulfur cluster assembly scaffold protein IscU |
Iron-sulfur cluster assembly scaffold protein IscU |
| iscA |
Gene: b2528: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: STM2541: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: CKO_00253: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: KPN_02860: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: Ent638_3025: Iron binding protein IscA for iron-sulfur cluster assembly |
|
Gene: y1336: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: Spro_3625: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: ECA3235: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: ETAE_2813: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: PMI1858: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: plu3281: Iron binding protein IscA for iron-sulfur cluster assembly |
Iron binding protein IscA for iron-sulfur cluster assembly |
| y1337 |
|
|
|
|
|
|
Gene: y1337: hypothetical |
|
|
|
|
|
unknown |
| hscB |
Gene: b2527: co-chaperone protein HscB |
Gene: STM2540: co-chaperone protein HscB |
Gene: CKO_00254: co-chaperone protein HscB |
Gene: KPN_02859: co-chaperone protein HscB |
Gene: Ent638_3024: co-chaperone protein HscB |
|
Gene: y1338: co-chaperone protein HscB |
Gene: Spro_3624: co-chaperone protein HscB |
Gene: ECA3234: co-chaperone protein HscB |
Gene: ETAE_2812: co-chaperone protein HscB |
Gene: PMI1857: co-chaperone protein HscB |
Gene: plu3280: co-chaperone protein HscB |
Chaperone protein hscB (HSC20) |
| hscA |
Gene: b2526: Chaperone protein HscA |
Gene: STM2539: Chaperone protein HscA |
Gene: CKO_00255: Chaperone protein HscA |
Gene: KPN_02858: Chaperone protein HscA |
Gene: Ent638_3023: Chaperone protein HscA |
|
Gene: y1339: Chaperone protein HscA |
Gene: Spro_3623: Chaperone protein HscA |
Gene: ECA3233: Chaperone protein HscA |
Gene: ETAE_2811: Chaperone protein HscA |
Gene: PMI1856: Chaperone protein HscA |
Gene: plu3279: Chaperone protein HscA |
Chaperone protein HscA |
| fdx |
Gene: b2525: ferredoxin, 2Fe-2S type, ISC system |
Gene: STM2538: ferredoxin, 2Fe-2S type, ISC system |
Gene: CKO_00256: ferredoxin, 2Fe-2S type, ISC system |
Gene: KPN_02857: ferredoxin, 2Fe-2S type, ISC system |
Gene: Ent638_3022: ferredoxin, 2Fe-2S type, ISC system |
|
Gene: y1340: ferredoxin, 2Fe-2S type, ISC system |
Gene: Spro_3622: ferredoxin, 2Fe-2S type, ISC system |
Gene: ECA3232: ferredoxin, 2Fe-2S type, ISC system |
Gene: ETAE_2810: ferredoxin, 2Fe-2S type, ISC system |
Gene: PMI1855: ferredoxin, 2Fe-2S type, ISC system |
Gene: plu3278: ferredoxin, 2Fe-2S type, ISC system |
ferredoxin, 2Fe-2S type, ISC system |
| yfhJ |
Gene: b2524: putative Fe-S cluster assembly protein |
Gene: STM2537: putative Fe-S cluster assembly protein |
Gene: CKO_00257: putative Fe-S cluster assembly protein |
Gene: KPN_02856: putative Fe-S cluster assembly protein |
Gene: Ent638_3021: putative Fe-S cluster assembly protein |
|
Gene: y1341: putative Fe-S cluster assembly protein |
Gene: Spro_3621: putative Fe-S cluster assembly protein |
Gene: ECA3231: putative Fe-S cluster assembly protein |
Gene: ETAE_2809: putative Fe-S cluster assembly protein |
Gene: PMI1854: putative Fe-S cluster assembly protein |
Gene: plu3277: putative Fe-S cluster assembly protein |
putative Fe-S cluster assembly protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |