Regulon of IscR in Escherichia coli str. K-12 substr. MG1655

Properties
Regulator type:	Transcription factor
TF locus tag:	b2531
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Enterobacteriales
Statistics of regulated genes:
- Genes	10
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 45 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -133 Score: 6.7 Sequence: ATACCCGACTAAATCAGTCAAGTAA Position: -108 Score: 5.8 Sequence: ATAGTTGACCAATTTACTCGGGAAT Locus tag: b2531 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: b2530 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: b2529 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: b2528 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: b2527 Name: hscB Funciton: co-chaperone protein HscB Locus tag: b2526 Name: hscA Funciton: Chaperone protein HscA Locus tag: b2525 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system Locus tag: b2524 Name: yfhJ Funciton: putative Fe-S cluster assembly protein
	b2531	iscR	Iron-sulfur cluster regulator IscR
	b2530	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	b2529	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	b2528	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	b2527	hscB	co-chaperone protein HscB
	b2526	hscA	Chaperone protein HscA
	b2525	fdx	ferredoxin, 2Fe-2S type, ISC system
	b2524	yfhJ	putative Fe-S cluster assembly protein
Position: -37 Score: 6.9 Sequence: ATAACCAACTAAAATAGTCAACTAT Locus tag: b3414 Name: nfuA Funciton: NfuA Fe-S protein maturation
	b3414	nfuA	NfuA Fe-S protein maturation
Position: -89 Score: 4.9 Sequence: ATACTTGAACGAAATACCAGGGTAT Locus tag: b0156 Name: erpA Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
	b0156	erpA	ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD