Regulon of IscR in Yersinia pestis KIM

Properties
Regulator type:	Transcription factor
TF locus tag:	y1333
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Enterobacteriales
Statistics of regulated genes:
- Genes	11
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 45 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -37 Score: 6.3 Sequence: ATAACCGACAAGAGTAGTCAACTAT Locus tag: y3903 Name: nfuA Funciton: NfuA Fe-S protein maturation
	y3903	nfuA	NfuA Fe-S protein maturation
Position: -103 Score: 6 Sequence: GTACTTGAATGAAATACTCAGGTAT Locus tag: y0801 Name: erpA Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
	y0801	erpA	ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
Position: -29 Score: 5.3 Sequence: ATAGTTGAGTGAATTACTAGGTTAA Position: -4 Score: 6.6 Sequence: ATAGTTGACTAAAACACTCAAGAAT Locus tag: y1333 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: y1334 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: y1335 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: y1336 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: y1337 Name: null Funciton: hypothetical Locus tag: y1338 Name: hscB Funciton: co-chaperone protein HscB Locus tag: y1339 Name: hscA Funciton: Chaperone protein HscA Locus tag: y1340 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system Locus tag: y1341 Name: yfhJ Funciton: putative Fe-S cluster assembly protein
	y1333	iscR	Iron-sulfur cluster regulator IscR
	y1334	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	y1335	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	y1336	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	y1337		hypothetical
	y1338	hscB	co-chaperone protein HscB
	y1339	hscA	Chaperone protein HscA
	y1340	fdx	ferredoxin, 2Fe-2S type, ISC system
	y1341	yfhJ	putative Fe-S cluster assembly protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD