Regulon of IscR in Enterobacter sp. 638

Properties
Regulator type:	Transcription factor
TF locus tag:	Ent638_3028
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Enterobacteriales
Statistics of regulated genes:
- Genes	10
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 45 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -37 Score: 6.1 Sequence: ATACCCAAGTATTTTAGTCAACTAT Locus tag: Ent638_3827 Name: nfuA Funciton: NfuA Fe-S protein maturation
	Ent638_3827	nfuA	NfuA Fe-S protein maturation
Position: -87 Score: 5.1 Sequence: ATACTTGAATGAATTACCAGGGTAT Locus tag: Ent638_0696 Name: erpA Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
	Ent638_0696	erpA	ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
Position: -131 Score: 6.8 Sequence: ATACCTGACTAAAACAGTCAAGTAA Position: -106 Score: 5.9 Sequence: ATAGTTGACCAATTTAGTCGGGAAT Locus tag: Ent638_3028 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: Ent638_3027 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: Ent638_3026 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: Ent638_3025 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: Ent638_3024 Name: hscB Funciton: co-chaperone protein HscB Locus tag: Ent638_3023 Name: hscA Funciton: Chaperone protein HscA Locus tag: Ent638_3022 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system Locus tag: Ent638_3021 Name: yfhJ Funciton: putative Fe-S cluster assembly protein
	Ent638_3028	iscR	Iron-sulfur cluster regulator IscR
	Ent638_3027	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	Ent638_3026	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	Ent638_3025	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	Ent638_3024	hscB	co-chaperone protein HscB
	Ent638_3023	hscA	Chaperone protein HscA
	Ent638_3022	fdx	ferredoxin, 2Fe-2S type, ISC system
	Ent638_3021	yfhJ	putative Fe-S cluster assembly protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD