Regulon of IscR in Erwinia amylovora ATCC 49946

Properties
Regulator type:	Transcription factor
TF locus tag:	EAM_2493
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Enterobacteriales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 45 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -37 Score: 6.7 Sequence: ATAACCAACTGAATTAGTCAACTAT Locus tag: EAM_3259 Name: nfuA Funciton: NfuA Fe-S protein maturation
	EAM_3259	nfuA	NfuA Fe-S protein maturation
Position: -138 Score: 4.9 Sequence: ATAGTTGAGTAAATTACCAGGTTAA Position: -88 Score: 5.9 Sequence: ATACTTGACCAATTTACTCGGGAAT Locus tag: EAM_2493 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: EAM_2492 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	EAM_2493	iscR	Iron-sulfur cluster regulator IscR
	EAM_2492	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD