Regulon of IscR in Erwinia carotovora subsp. atroseptica SCRI1043

Properties
Regulator type:	Transcription factor
TF locus tag:	ECA3238
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Enterobacteriales
Statistics of regulated genes:
- Genes	9
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 45 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -105 Score: 5.2 Sequence: ATACTTGAGTGTTTTACTCGGTTAA Position: -80 Score: 6.2 Sequence: ATAGTTGACTAAAACACTCGGGAAT Locus tag: ECA3238 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: ECA3237 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: ECA3236 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: ECA3235 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: ECA3234 Name: hscB Funciton: co-chaperone protein HscB Locus tag: ECA3233 Name: hscA Funciton: Chaperone protein HscA Locus tag: ECA3232 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system Locus tag: ECA3231 Name: yfhJ Funciton: putative Fe-S cluster assembly protein
	ECA3238	iscR	Iron-sulfur cluster regulator IscR
	ECA3237	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	ECA3236	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	ECA3235	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	ECA3234	hscB	co-chaperone protein HscB
	ECA3233	hscA	Chaperone protein HscA
	ECA3232	fdx	ferredoxin, 2Fe-2S type, ISC system
	ECA3231	yfhJ	putative Fe-S cluster assembly protein
Position: -38 Score: 5.6 Sequence: ATAACCGATAAGTGCAGTCAACTAT Locus tag: ECA4134 Name: nfuA Funciton: NfuA Fe-S protein maturation
	ECA4134	nfuA	NfuA Fe-S protein maturation

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD