Regulog Zur - Ralstonia

Properties
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Proteobacteria/beta
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By taxonomy - Ralstonia
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Statistics of regulated genes
Genome	Genes	Operons
Ralstonia solanacearum GMI1000	8	4
Ralstonia pickettii 12J	8	4
Ralstonia metallidurans CH34	5	3
Ralstonia eutropha JMP134	4	2
Ralstonia eutropha H16	9	3
Cupriavidus taiwanensis	4	2

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes							Function

CRON 1.
zip	* Ralstonia solanacearum GMI1000 Site: position = -37 score = 5.93645 sequence = TTCTTGCAACTCTGTTGCGTTTG Gene: RS01372: Zinc transporter, ZIP family	* Ralstonia pickettii 12J Site: position = -48 score = 6.00209 sequence = TTCTTGCAACTCTGTTGCGTTTA Gene: Rpic_2432: Zinc transporter, ZIP family	* Ralstonia metallidurans CH34 Site: position = -26 score = 6.42071 sequence = TTTTTGCAACATTGTTGCGTTAA Gene: Rmet_2621: Zinc transporter, ZIP family	* Ralstonia eutropha JMP134 Site: position = -3 score = 6.30203 sequence = TTGTTGCAACATTGTTGCGTTTG Gene: Reut_A0876: Zinc transporter, ZIP family	* Ralstonia eutropha H16 Site: position = -35 score = 6.41473 sequence = TTATTGCAACATTGTTGCGTTAG Gene: H16_A2738: Zinc transporter, ZIP family	* Cupriavidus taiwanensis Site: position = -35 score = 6.40275 sequence = TTATTGCAACATTGTTGCGTTTG Gene: RALTA_A2241: Zinc transporter, ZIP family	Zinc transporter, ZIP family

CRON 2.
h16_B2121	Ralstonia solanacearum GMI1000	Ralstonia pickettii 12J	Ralstonia metallidurans CH34	Ralstonia eutropha JMP134	* Ralstonia eutropha H16 Site: position = -58 score = 5.51211 sequence = CAATTGCAATTGAGTTGCGTTAA Gene: H16_B2121: hypothetical protein	Cupriavidus taiwanensis	hypothetical protein
omr3	Ralstonia solanacearum GMI1000	Ralstonia pickettii 12J	Ralstonia metallidurans CH34	Ralstonia eutropha JMP134	Ralstonia eutropha H16 Gene: H16_B2120: predicted zinc-related TonB-dependent outer membrane transporter	Cupriavidus taiwanensis	predicted zinc-related TonB-dependent outer membrane transporter
ABC_Zn_A	Ralstonia solanacearum GMI1000	Ralstonia pickettii 12J	Ralstonia metallidurans CH34	Ralstonia eutropha JMP134	Ralstonia eutropha H16 Gene: H16_B2119: ABC-type transporter, ATPase component	Cupriavidus taiwanensis	predicted ABC transporter for zinc, ATPase component
ABC_Zn_P	Ralstonia solanacearum GMI1000	Ralstonia pickettii 12J	Ralstonia metallidurans CH34	Ralstonia eutropha JMP134	Ralstonia eutropha H16 Gene: H16_B2118: hypothetical membrane spanning protein	Cupriavidus taiwanensis	predicted ABC transporter for zinc, permease component
ABC_Zn_P2	Ralstonia solanacearum GMI1000	Ralstonia pickettii 12J	Ralstonia metallidurans CH34	Ralstonia eutropha JMP134	Ralstonia eutropha H16 Gene: H16_B2117: ABC-type transporter, permease component	Cupriavidus taiwanensis	predicted ABC transporter for zinc, permease component 2

CRON 3.
omr2	* Ralstonia solanacearum GMI1000 Site: position = -114 score = 6.11076 sequence = TATTTGCAACAGAGTTGCAAATT Gene: RS00125: predicted zinc-related TonB-dependent outer membrane transporter	Ralstonia pickettii 12J	Ralstonia metallidurans CH34	Ralstonia eutropha JMP134	Ralstonia eutropha H16 Gene: H16_B0785: predicted zinc-related TonB-dependent outer membrane transporter	Cupriavidus taiwanensis Gene: RALTA_B0619: predicted zinc-related TonB-dependent outer membrane transporter	predicted zinc-related TonB-dependent outer membrane transporter
h16_B0786	Ralstonia solanacearum GMI1000 Gene: RS00126: hypothetical protein	Ralstonia pickettii 12J	Ralstonia metallidurans CH34	Ralstonia eutropha JMP134	Ralstonia eutropha H16 Gene: H16_B0786: hypothetical protein	Cupriavidus taiwanensis Gene: RALTA_B0620: hypothetical protein	hypothetical protein

CRON 4.
yciC2	Ralstonia solanacearum GMI1000	Ralstonia pickettii 12J	* Ralstonia metallidurans CH34 Site: position = -71 score = 6.13939 sequence = TGTTTGCAACAATGTTGCATTAA Site: position = -99 score = 5.63588 sequence = GAAATGCAACAAGGTTGCATTTA Gene: Rmet_1098: Putative zinc chaperone, COG0523 family	Ralstonia eutropha JMP134	Ralstonia eutropha H16	Cupriavidus taiwanensis	Putative zinc chaperone, COG0523 family

CRON 5.
tonB	* Ralstonia solanacearum GMI1000 Site: position = -220 score = 6.00836 sequence = TTGTCGCAACACTGTTGCATGAA Gene: RSc1963: Component of outer membrane metal uptake system, TonB family	* Ralstonia pickettii 12J Site: position = -223 score = 5.90276 sequence = TTGTCGCAACACTGTTGCAGTTG Gene: Rpic_2116: Component of outer membrane metal uptake system, TonB family	Ralstonia metallidurans CH34 Gene: Rmet_2277: Component of outer membrane metal uptake system, TonB family	Ralstonia eutropha JMP134 Gene: Reut_A2235: Component of outer membrane metal uptake system, TonB family	Ralstonia eutropha H16 Gene: H16_A2532: Component of outer membrane metal uptake system, TonB family	Cupriavidus taiwanensis Gene: RALTA_A2036: Component of outer membrane metal uptake system, TonB family	Component of outer membrane metal uptake system, TonB family
exbB	Ralstonia solanacearum GMI1000 Gene: RSc1964: Component of outer membrane metal uptake system, ExbB family	Ralstonia pickettii 12J Gene: Rpic_2117: Component of outer membrane metal uptake system, ExbB family	Ralstonia metallidurans CH34 Gene: Rmet_2278: Component of outer membrane metal uptake system, ExbB family	Ralstonia eutropha JMP134 Gene: Reut_A2236: Component of outer membrane metal uptake system, ExbB family	Ralstonia eutropha H16 Gene: H16_A2533: Component of outer membrane metal uptake system, ExbB family	Cupriavidus taiwanensis Gene: RALTA_A2037: Component of outer membrane metal uptake system, ExbB family	Component of outer membrane metal uptake system, ExbB family
exbD	Ralstonia solanacearum GMI1000 Gene: RSc1965: Component of outer membrane metal uptake system, ExbD family	Ralstonia pickettii 12J Gene: Rpic_2118: Component of outer membrane metal uptake system, ExbD family	Ralstonia metallidurans CH34 Gene: Rmet_2279: Component of outer membrane metal uptake system, ExbD family	Ralstonia eutropha JMP134 Gene: Reut_A2237: Component of outer membrane metal uptake system, ExbD family	Ralstonia eutropha H16 Gene: H16_A2534: Component of outer membrane metal uptake system, ExbD family	Cupriavidus taiwanensis Gene: RALTA_A2038: Component of outer membrane metal uptake system, ExbD family	Component of outer membrane metal uptake system, ExbD family

CRON 6.
yciC	Ralstonia solanacearum GMI1000	Ralstonia pickettii 12J Gene: Rpic_3703: Putative zinc chaperone, COG0523 family	* Ralstonia metallidurans CH34 Site: position = -34 score = 6.1063 sequence = CAGTCGCAACTTTGTTGCATCAA Gene: Rmet_0125: Putative zinc chaperone, COG0523 family	* Ralstonia eutropha JMP134 Site: position = -66 score = 6.31073 sequence = CAGTCGCAACTTTGTTGCAATAA Gene: Reut_A0161: Putative zinc chaperone, COG0523 family	* Ralstonia eutropha H16 Site: position = -75 score = 5.96793 sequence = AATTCGCAACCTTGTTGCAACAA Gene: H16_A0193: Putative zinc chaperone, COG0523 family	* Cupriavidus taiwanensis Site: position = -76 score = 5.9023 sequence = AATTCGCAACCTTGTTGCAACAG Gene: RALTA_A0136: Putative zinc chaperone, COG0523 family	Putative zinc chaperone, COG0523 family
h16_A0192	* Ralstonia solanacearum GMI1000 Site: position = -95 score = 5.74979 sequence = AATTCGCAACTTAGTTGCATTGG Gene: RS04852: hypothetical transmembrane protein	* Ralstonia pickettii 12J Site: position = -31 score = 5.74979 sequence = AATTCGCAACTTAGTTGCATTGG Gene: Rpic_0521: hypothetical transmembrane protein	Ralstonia metallidurans CH34 Gene: Rmet_0124: hypothetical transmembrane protein	Ralstonia eutropha JMP134 Gene: Reut_A0160: hypothetical transmembrane protein	Ralstonia eutropha H16 Gene: H16_A0192: hypothetical transmembrane protein	Cupriavidus taiwanensis Gene: RALTA_A0135: hypothetical transmembrane protein	hypothetical transmembrane protein
omr	Ralstonia solanacearum GMI1000 Gene: RS04851: predicted zinc-related TonB-dependent outer membrane transporter	Ralstonia pickettii 12J Gene: Rpic_0522: predicted zinc-related TonB-dependent outer membrane transporter	Ralstonia metallidurans CH34 Gene: Rmet_0123: predicted zinc-related TonB-dependent outer membrane transporter	Ralstonia eutropha JMP134 Gene: Reut_A0159: predicted zinc-related TonB-dependent outer membrane transporter	Ralstonia eutropha H16 Gene: H16_A0191: predicted zinc-related TonB-dependent outer membrane transporter	Cupriavidus taiwanensis Gene: RALTA_A0134: predicted zinc-related TonB-dependent outer membrane transporter	predicted zinc-related TonB-dependent outer membrane transporter
zur	Ralstonia solanacearum GMI1000	* Ralstonia pickettii 12J Site: position = -50 score = 5.18457 sequence = CAATTGCAACTCAATTGCAGCAA Gene: Rpic_3702: Zinc uptake regulator, Fur family	Ralstonia metallidurans CH34	Ralstonia eutropha JMP134	Ralstonia eutropha H16	Cupriavidus taiwanensis	Zinc uptake regulator, Fur family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog Zur - Ralstonia

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --