Regulog Zur - Ralstonia
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Proteobacteria/beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Ralstonia
- By trascription factor - Zur
- By TF family - FUR
- By effector - Zinc ion, (Zn2+)
- By pathway - Zinc homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Ralstonia solanacearum GMI1000 | 8 | 4 |
| Ralstonia pickettii 12J | 8 | 4 |
| Ralstonia metallidurans CH34 | 5 | 3 |
| Ralstonia eutropha JMP134 | 4 | 2 |
| Ralstonia eutropha H16 | 9 | 3 |
| Cupriavidus taiwanensis | 4 | 2 |
| Genes | Function | ||||||
|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||
| zip |
*
Ralstonia solanacearum GMI1000 Site: position = -37 score = 5.93645 sequence = TTCTTGCAACTCTGTTGCGTTTG Gene: RS01372: Zinc transporter, ZIP family |
*
Ralstonia pickettii 12J Site: position = -48 score = 6.00209 sequence = TTCTTGCAACTCTGTTGCGTTTA Gene: Rpic_2432: Zinc transporter, ZIP family |
*
Ralstonia metallidurans CH34 Site: position = -26 score = 6.42071 sequence = TTTTTGCAACATTGTTGCGTTAA Gene: Rmet_2621: Zinc transporter, ZIP family |
*
Ralstonia eutropha JMP134 Site: position = -3 score = 6.30203 sequence = TTGTTGCAACATTGTTGCGTTTG Gene: Reut_A0876: Zinc transporter, ZIP family |
*
Ralstonia eutropha H16 Site: position = -35 score = 6.41473 sequence = TTATTGCAACATTGTTGCGTTAG Gene: H16_A2738: Zinc transporter, ZIP family |
*
Cupriavidus taiwanensis Site: position = -35 score = 6.40275 sequence = TTATTGCAACATTGTTGCGTTTG Gene: RALTA_A2241: Zinc transporter, ZIP family |
Zinc transporter, ZIP family |
| CRON 2. | |||||||
| h16_B2121 |
|
|
|
|
*
Ralstonia eutropha H16 Site: position = -58 score = 5.51211 sequence = CAATTGCAATTGAGTTGCGTTAA Gene: H16_B2121: hypothetical protein |
|
hypothetical protein |
| omr3 |
|
|
|
|
Gene: H16_B2120: predicted zinc-related TonB-dependent outer membrane transporter |
|
predicted zinc-related TonB-dependent outer membrane transporter |
| ABC_Zn_A |
|
|
|
|
Gene: H16_B2119: ABC-type transporter, ATPase component |
|
predicted ABC transporter for zinc, ATPase component |
| ABC_Zn_P |
|
|
|
|
Gene: H16_B2118: hypothetical membrane spanning protein |
|
predicted ABC transporter for zinc, permease component |
| ABC_Zn_P2 |
|
|
|
|
Gene: H16_B2117: ABC-type transporter, permease component |
|
predicted ABC transporter for zinc, permease component 2 |
| CRON 3. | |||||||
| omr2 |
*
Ralstonia solanacearum GMI1000 Site: position = -114 score = 6.11076 sequence = TATTTGCAACAGAGTTGCAAATT Gene: RS00125: predicted zinc-related TonB-dependent outer membrane transporter |
|
|
|
Gene: H16_B0785: predicted zinc-related TonB-dependent outer membrane transporter |
Gene: RALTA_B0619: predicted zinc-related TonB-dependent outer membrane transporter |
predicted zinc-related TonB-dependent outer membrane transporter |
| h16_B0786 |
Gene: RS00126: hypothetical protein |
|
|
|
Gene: H16_B0786: hypothetical protein |
Gene: RALTA_B0620: hypothetical protein |
hypothetical protein |
| CRON 4. | |||||||
| yciC2 |
|
|
*
Ralstonia metallidurans CH34 Site: position = -71 score = 6.13939 sequence = TGTTTGCAACAATGTTGCATTAA Site: position = -99 score = 5.63588 sequence = GAAATGCAACAAGGTTGCATTTA Gene: Rmet_1098: Putative zinc chaperone, COG0523 family |
|
|
|
Putative zinc chaperone, COG0523 family |
| CRON 5. | |||||||
| tonB |
*
Ralstonia solanacearum GMI1000 Site: position = -220 score = 6.00836 sequence = TTGTCGCAACACTGTTGCATGAA Gene: RSc1963: Component of outer membrane metal uptake system, TonB family |
*
Ralstonia pickettii 12J Site: position = -223 score = 5.90276 sequence = TTGTCGCAACACTGTTGCAGTTG Gene: Rpic_2116: Component of outer membrane metal uptake system, TonB family |
Gene: Rmet_2277: Component of outer membrane metal uptake system, TonB family |
Gene: Reut_A2235: Component of outer membrane metal uptake system, TonB family |
Gene: H16_A2532: Component of outer membrane metal uptake system, TonB family |
Gene: RALTA_A2036: Component of outer membrane metal uptake system, TonB family |
Component of outer membrane metal uptake system, TonB family |
| exbB |
Gene: RSc1964: Component of outer membrane metal uptake system, ExbB family |
Gene: Rpic_2117: Component of outer membrane metal uptake system, ExbB family |
Gene: Rmet_2278: Component of outer membrane metal uptake system, ExbB family |
Gene: Reut_A2236: Component of outer membrane metal uptake system, ExbB family |
Gene: H16_A2533: Component of outer membrane metal uptake system, ExbB family |
Gene: RALTA_A2037: Component of outer membrane metal uptake system, ExbB family |
Component of outer membrane metal uptake system, ExbB family |
| exbD |
Gene: RSc1965: Component of outer membrane metal uptake system, ExbD family |
Gene: Rpic_2118: Component of outer membrane metal uptake system, ExbD family |
Gene: Rmet_2279: Component of outer membrane metal uptake system, ExbD family |
Gene: Reut_A2237: Component of outer membrane metal uptake system, ExbD family |
Gene: H16_A2534: Component of outer membrane metal uptake system, ExbD family |
Gene: RALTA_A2038: Component of outer membrane metal uptake system, ExbD family |
Component of outer membrane metal uptake system, ExbD family |
| CRON 6. | |||||||
| yciC |
|
Gene: Rpic_3703: Putative zinc chaperone, COG0523 family |
*
Ralstonia metallidurans CH34 Site: position = -34 score = 6.1063 sequence = CAGTCGCAACTTTGTTGCATCAA Gene: Rmet_0125: Putative zinc chaperone, COG0523 family |
*
Ralstonia eutropha JMP134 Site: position = -66 score = 6.31073 sequence = CAGTCGCAACTTTGTTGCAATAA Gene: Reut_A0161: Putative zinc chaperone, COG0523 family |
*
Ralstonia eutropha H16 Site: position = -75 score = 5.96793 sequence = AATTCGCAACCTTGTTGCAACAA Gene: H16_A0193: Putative zinc chaperone, COG0523 family |
*
Cupriavidus taiwanensis Site: position = -76 score = 5.9023 sequence = AATTCGCAACCTTGTTGCAACAG Gene: RALTA_A0136: Putative zinc chaperone, COG0523 family |
Putative zinc chaperone, COG0523 family |
| h16_A0192 |
*
Ralstonia solanacearum GMI1000 Site: position = -95 score = 5.74979 sequence = AATTCGCAACTTAGTTGCATTGG Gene: RS04852: hypothetical transmembrane protein |
*
Ralstonia pickettii 12J Site: position = -31 score = 5.74979 sequence = AATTCGCAACTTAGTTGCATTGG Gene: Rpic_0521: hypothetical transmembrane protein |
Gene: Rmet_0124: hypothetical transmembrane protein |
Gene: Reut_A0160: hypothetical transmembrane protein |
Gene: H16_A0192: hypothetical transmembrane protein |
Gene: RALTA_A0135: hypothetical transmembrane protein |
hypothetical transmembrane protein |
| omr |
Gene: RS04851: predicted zinc-related TonB-dependent outer membrane transporter |
Gene: Rpic_0522: predicted zinc-related TonB-dependent outer membrane transporter |
Gene: Rmet_0123: predicted zinc-related TonB-dependent outer membrane transporter |
Gene: Reut_A0159: predicted zinc-related TonB-dependent outer membrane transporter |
Gene: H16_A0191: predicted zinc-related TonB-dependent outer membrane transporter |
Gene: RALTA_A0134: predicted zinc-related TonB-dependent outer membrane transporter |
predicted zinc-related TonB-dependent outer membrane transporter |
| zur |
|
*
Ralstonia pickettii 12J Site: position = -50 score = 5.18457 sequence = CAATTGCAACTCAATTGCAGCAA Gene: Rpic_3702: Zinc uptake regulator, Fur family |
|
|
|
|
Zinc uptake regulator, Fur family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |